CRISPR

CRISPR1-myog

ID

ZDB-CRISPR-190125-5

Name

CRISPR1-myog

Previous Names

None

Target

myog (1)

Sequence

5' - GGAGCTCCTGTCCTGATATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
kg125	myog
kg128	myog

Expression

Gene expression in Wild Types + CRISPR1-myog

No data available

Phenotype

Phenotype resulting from CRISPR1-myog

No data available

Phenotype of all Fish created by or utilizing CRISPR1-myog

Phenotype	Fish	Conditions	Figures
whole organism myf6 expression decreased amount, abnormal	myog^kg125/kg125 (TL)	standard conditions	Fig. 2 from Ganassi et al., 2018
myotome skeletal muscle cell myog expression absent, abnormal	myog^kg125/kg125 (TL)	standard conditions	Fig. 1 from Ganassi et al., 2018
myotome skeletal muscle cell myog expression decreased amount, abnormal	myog^kg125/kg125 (TL)	standard conditions	Fig. 1 from Ganassi et al., 2018
whole organism myog expression decreased amount, abnormal	myog^kg125/kg125 (TL)	standard conditions	Fig. 1 from Ganassi et al., 2018
myotome fast muscle cell disorganized, abnormal	myog^kg125/kg125 (TL)	standard conditions	Fig. 2 from Ganassi et al., 2018
whole organism mymk expression decreased amount, abnormal	myog^kg125/kg125 (TL)	control	Fig. 5 , Fig. 6 from Ganassi et al., 2018
myotome skeletal muscle tissue development decreased process quality, abnormal	myog^kg125/kg125 (TL)	control	Fig. 6 from Ganassi et al., 2018
whole organism mymx expression decreased amount, abnormal	myog^kg125/kg125 (TL)	standard conditions	Fig. 5 from Ganassi et al., 2018
somite skeletal muscle cell mymk expression decreased amount, abnormal	myog^kg125/kg125 (TL)	chemical treatment by environment: Cyclopamine	Fig. 6 from Ganassi et al., 2018
whole organism mymk expression decreased amount, abnormal	myog^kg125/kg125 (TL)	chemical treatment by environment: Cyclopamine	Fig. 6 from Ganassi et al., 2018
whole organism jam3b expression decreased amount, abnormal	myog^kg125/kg125 (TL)	standard conditions	Fig. 5 from Ganassi et al., 2018
myotome skeletal muscle tissue development decreased process quality, exacerbated	myog^kg125/kg125 (TL)	chemical treatment by environment: Cyclopamine	Fig. 6 from Ganassi et al., 2018
whole organism decreased weight, abnormal	myog^kg125/kg125 (TL)	standard conditions	Fig. 7 from Ganassi et al., 2018
somite skeletal muscle cell mymk expression decreased amount, abnormal	myog^kg125/kg125 (TL)	control	Fig. 6 from Ganassi et al., 2018
skeletal muscle cell nucleus myog expression absent, abnormal	myog^kg125/kg125 (TL)	standard conditions	Fig. 1 from Ganassi et al., 2018
whole organism myf5 expression decreased amount, abnormal	myog^kg125/kg125 (TL)	standard conditions	Fig. 2 from Ganassi et al., 2018
myotome decreased height, abnormal	myog^kg128/kg128 (TL)	standard conditions	Fig. 3 from Ganassi et al., 2018
myotome skeletal muscle cell myog expression decreased amount, abnormal	myog^kg128/kg128 (TL)	standard conditions	Fig. 1 from Ganassi et al., 2018
myotome fast muscle cell decreased area, abnormal	myog^kg128/kg128 (TL)	standard conditions	Fig. 7 from Ganassi et al., 2018
fast muscle cell has fewer parts of type fast muscle cell nucleus, abnormal	myog^kg128/kg128 (TL)	standard conditions	Fig. 7 from Ganassi et al., 2018
whole organism decreased weight, abnormal	myog^kg128/kg128 (TL)	standard conditions	Fig. 7 from Ganassi et al., 2018
somite skeletal muscle cell mymk expression decreased amount, abnormal	myog^kg128/kg128 (TL)	standard conditions	Fig. 5 from Ganassi et al., 2018
somite skeletal muscle cell jam3b expression decreased amount, abnormal	myog^kg128/kg128 (TL)	standard conditions	Fig. 5 from Ganassi et al., 2018
myotome has extra parts of type fast muscle cell, abnormal	myog^kg128/kg128 (TL)	standard conditions	Fig. 7 from Ganassi et al., 2018
fast muscle cell myoblast fusion decreased occurrence, abnormal	myog^kg125/kg125; vu119Tg	control	Fig. 6 from Ganassi et al., 2018
fast muscle cell myoblast fusion decreased occurrence, exacerbated	myog^kg125/kg125; vu119Tg	chemical treatment by environment: Cyclopamine	Fig. 6 from Ganassi et al., 2018
fast muscle cell has fewer parts of type fast muscle cell nucleus, abnormal	myog^kg128/kg128; vu119Tg	standard conditions	Fig. 4 from Ganassi et al., 2018
myotome has extra parts of type fast muscle cell, abnormal	myog^kg128/kg128; vu119Tg	standard conditions	Fig. 3 from Ganassi et al., 2018
fast muscle cell myoblast fusion decreased occurrence, abnormal	myog^kg128/kg128; vu119Tg	standard conditions	Fig. 4 from Ganassi et al., 2018
myotome fast muscle cell decreased volume, abnormal	myog^kg128/kg128; vu119Tg	standard conditions	Fig. 3 from Ganassi et al., 2018
fast muscle cell nucleus centered, abnormal	myog^kg128/kg128; vu119Tg	standard conditions	Fig. 4 from Ganassi et al., 2018
myotome decreased volume, abnormal	myog^kg128/kg128; vu119Tg	standard conditions	Fig. 3 from Ganassi et al., 2018

Citations