CRISPR

CRISPR3-ybx1

ID

ZDB-CRISPR-190124-1

Name

CRISPR3-ybx1

Previous Names

None

Target

ybx1 (1)

Sequence

5' - CGGGGGATAAGAAGGTCATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
tsu3d5i	ybx1

Expression

Gene expression in Wild Types + CRISPR3-ybx1

No data available

Phenotype

Phenotype resulting from CRISPR3-ybx1

No data available

Phenotype of all Fish created by or utilizing CRISPR3-ybx1

Phenotype	Fish	Conditions	Figures
oocyte stage V immature, abnormal	ybx1^{tsu3d5i/tsu3d5i} (TU)	standard conditions	Fig. 2 from Sun et al., 2018
oocyte stage V proteolysis decreased occurrence, abnormal	ybx1^{tsu3d5i/tsu3d5i} (TU)	standard conditions	Fig. 2 from Sun et al., 2018
oocyte stage V opaque, abnormal	ybx1^{tsu3d5i/tsu3d5i} (TU)	standard conditions	Fig. 2 from Sun et al., 2018
oocyte maturation decreased occurrence, abnormal	ybx1^{tsu3d5i/tsu3d5i} (TU)	standard conditions	Fig. 2 from Sun et al., 2018
whole organism grhl3 expression decreased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4 from Sun et al., 2018
whole organism wnt11f2 expression decreased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4, Fig. 7 from Sun et al., 2018
whole organism apoeb expression decreased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4 from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second arrested, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 1 , Fig. 7 from Sun et al., 2018
egg activation process quality, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 7 from Sun et al., 2018
whole organism ripor3 expression increased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4, Fig. 7 from Sun et al., 2018
oocyte stage V proteolysis decreased occurrence, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 7 from Sun et al., 2018
whole organism cxcr4b expression decreased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4 from Sun et al., 2018
whole organism btg4 expression increased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4, Fig. 7 from Sun et al., 2018
whole organism double-stranded DNA fragment decreased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 3 from Sun et al., 2018
whole organism ybx1 expression decreased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 1 from Sun et al., 2018
blastomere nucleus broken, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 2 from Sun et al., 2018
whole organism slc35f2 expression increased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4 from Sun et al., 2018
whole organism nnr expression decreased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4, Fig. 7 from Sun et al., 2018
whole organism fgfr4 expression decreased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4, Fig. 7 from Sun et al., 2018
fertilized egg cortical granule increased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 2 from Sun et al., 2018
cell population proliferation process quality, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 3 from Sun et al., 2018
blastomere nuclear pore ab1-nucleoporin labeling absent, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 2 from Sun et al., 2018
whole organism cd82b expression increased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4 from Sun et al., 2018
whole organism casd1 expression increased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4 from Sun et al., 2018
translation increased occurrence, abnormal	ybx1^tsu3d5i/+ (TU)	control	Fig. 5 from Sun et al., 2018
blastomere ab18-h3 labeling decreased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 3 from Sun et al., 2018
whole organism dusp6 expression decreased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4, Fig. 7 from Sun et al., 2018
blastomere nuclear pore absent, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 2 from Sun et al., 2018
whole organism atf3 expression increased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 6 from Sun et al., 2018
endoplasmic reticulum unfolded protein response increased occurrence, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 6 from Sun et al., 2018
blastomere position, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 1 from Sun et al., 2018
cell cycle arrested, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 3 from Sun et al., 2018
whole organism vent expression decreased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4 from Sun et al., 2018
whole organism lipg expression increased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4, Fig. 7 from Sun et al., 2018
blastomere shape, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 1 from Sun et al., 2018
chorion decreased diameter, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 2 from Sun et al., 2018
blastomere plasma membrane structure, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 2 from Sun et al., 2018
whole organism acadl expression increased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4 from Sun et al., 2018
cleavage furrow formation decreased occurrence, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 2 from Sun et al., 2018
tubulin complex assembly decreased occurrence, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 2 from Sun et al., 2018
whole organism cldnd expression increased amount, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 4, Fig. 7 from Sun et al., 2018
cortical granule exocytosis decreased occurrence, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 2 from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second onset quality, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 1 , Fig. 7 from Sun et al., 2018
chorion decreased elevation, abnormal	ybx1^tsu3d5i/+ (TU)	standard conditions	Fig. 2 , Fig. 7 from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second occurrence, ameliorated	ybx1^tsu3d5i/+; tsu29Tg (TU)	standard conditions	Fig. 1 from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second onset quality, ameliorated	ybx1^tsu3d5i/+; tsu29Tg (TU)	standard conditions	Fig. 1 from Sun et al., 2018
oocyte stage V proteolysis occurrence, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018
whole organism btg4 expression amount, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018
whole organism lipg expression amount, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018
whole organism nnr expression amount, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018
whole organism fgfr4 expression amount, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018
egg activation process quality, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018
whole organism wnt11f2 expression amount, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018
chorion elevation, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018
whole organism cldnd expression amount, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018
whole organism ripor3 expression amount, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second occurrence, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018
whole organism dusp6 expression amount, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018
epiboly involved in gastrulation with mouth forming second onset quality, ameliorated	ybx1^tsu3d5i/+; tsu30Tg (TU)	standard conditions	Fig. 7 from Sun et al., 2018

Citations