CRISPR

CRISPR1-lrrc23

ID
ZDB-CRISPR-190102-2
Name
CRISPR1-lrrc23
Previous Names
None
Target
Sequence
5' - AGAGTCTTGTCCACTAACCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ouc2007 lrrc23
ouc2008 lrrc23
Expression
Gene expression in Wild Types + CRISPR1-lrrc23
No data available
Phenotype
Phenotype resulting from CRISPR1-lrrc23
No data available
Phenotype of all Fish created by or utilizing CRISPR1-lrrc23
Phenotype Fish Conditions Figures
otic vesicle otolith formation increased occurrence, abnormal lrrc23ouc2007/ouc2007 standard conditions Fig. 2 from Han et al., 2018
otic vesicle epithelial cilium movement involved in extracellular fluid movement decreased frequency, abnormal lrrc23ouc2007/ouc2007 standard conditions Fig. 4 from Han et al., 2018
otic vesicle otolith formation process quality, abnormal lrrc23ouc2007/ouc2007 standard conditions Fig. 3 from Han et al., 2018
otolith mislocalised, abnormal lrrc23ouc2007/ouc2007 standard conditions Fig. 3 from Han et al., 2018
sagitta increased size, abnormal lrrc23ouc2007/ouc2007 standard conditions Fig. 2 from Han et al., 2018
otic vesicle has extra parts of type otolith, abnormal lrrc23ouc2007/ouc2007 standard conditions Fig. 2 from Han et al., 2018
otic vesicle has extra parts of type otolith, exacerbated lrrc23ouc2007/ouc2007 chemical treatment by environment: methyl cellulose Fig. 2 from Han et al., 2018
otic vesicle otolith formation increased occurrence, exacerbated lrrc23ouc2007/ouc2007 chemical treatment by environment: methyl cellulose Fig. 2 from Han et al., 2018
sagitta ovate, abnormal lrrc23ouc2007/ouc2007 standard conditions Fig. 2 from Han et al., 2018
otic vesicle has fewer parts of type otic vesicle motile cilium, abnormal lrrc23ouc2007/ouc2007 standard conditions Fig. 4Fig. 5 from Han et al., 2018
otic vesicle otolith formation increased occurrence, abnormal lrrc23ouc2008/ouc2008 standard conditions Fig. 2 from Han et al., 2018
otic vesicle epithelial cilium movement involved in extracellular fluid movement decreased frequency, abnormal lrrc23ouc2008/ouc2008 standard conditions Fig. 4 from Han et al., 2018
otic vesicle otolith formation process quality, abnormal lrrc23ouc2008/ouc2008 standard conditions Fig. 3 from Han et al., 2018
otolith mislocalised, abnormal lrrc23ouc2008/ouc2008 standard conditions Fig. 3 from Han et al., 2018
otic vesicle has extra parts of type otolith, abnormal lrrc23ouc2008/ouc2008 standard conditions Fig. 2 from Han et al., 2018
sagitta increased size, abnormal lrrc23ouc2008/ouc2008 standard conditions Fig. 2 from Han et al., 2018
otic vesicle has fewer parts of type otic vesicle motile cilium, abnormal lrrc23ouc2008/ouc2008 standard conditions Fig. 4Fig. 5 from Han et al., 2018
otic vesicle otolith formation increased occurrence, exacerbated lrrc23ouc2008/ouc2008 chemical treatment by environment: methyl cellulose Fig. 2 from Han et al., 2018
otic vesicle has extra parts of type otolith, exacerbated lrrc23ouc2008/ouc2008 chemical treatment by environment: methyl cellulose Fig. 2 from Han et al., 2018
sagitta ovate, abnormal lrrc23ouc2008/ouc2008 standard conditions Fig. 2 from Han et al., 2018
Citations