CRISPR

CRISPR1-prmt7

ID

ZDB-CRISPR-181107-3

Name

CRISPR1-prmt7

Previous Names

None

Target

prmt7 (1)

Sequence

5' - GCAAATCCAACAACAGGAGCGCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ihbp4	prmt7
ihbp7	prmt7

Expression

Gene expression in Wild Types + CRISPR1-prmt7

No data available

Phenotype

Phenotype resulting from CRISPR1-prmt7

No data available

Phenotype of all Fish created by or utilizing CRISPR1-prmt7

Phenotype	Fish	Conditions	Figures
whole organism pkz expression increased amount, abnormal	prmt7^ihbp4/ihbp4 (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. S7 from Zhu et al., 2020
whole organism mxc expression increased amount, abnormal	prmt7^ihbp4/ihbp4 (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. S7 from Zhu et al., 2020
whole organism prmt7 expression decreased amount, abnormal	prmt7^ihbp4/ihbp4 (AB)	control	Fig. 5 from Zhu et al., 2020
whole organism ifnphi1 expression increased amount, abnormal	prmt7^ihbp4/ihbp4 (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. S7 from Zhu et al., 2020
hepatocyte vacuolated, ameliorated	prmt7^ihbp7/ihbp7 (AB)	viral treatment by injection: Sprivivirus cyprinus	Fig. 8 from Zhu et al., 2020
whole organism pkz expression increased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by exposure to environment: Viruses	Fig. S5 from Zhu et al., 2020
liver mxc expression increased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by injection: Sprivivirus cyprinus	Fig. 8 from Zhu et al., 2020
whole organism pkz expression increased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Zhu et al., 2020
defense response to virus increased efficacy, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by injection: Sprivivirus cyprinus	Fig. 8 from Zhu et al., 2020
liver ifnphi1 expression increased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by injection: Viruses	Fig. S6 from Zhu et al., 2020
whole organism ifnphi1 expression increased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by exposure to environment: Viruses	Fig. S5 from Zhu et al., 2020
whole organism mxc expression increased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Zhu et al., 2020
liver pkz expression increased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by injection: Sprivivirus cyprinus	Fig. 8 from Zhu et al., 2020
whole organism prmt7 expression decreased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	control	Fig. 5 from Zhu et al., 2020
whole organism mxc expression increased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by exposure to environment: Viruses	Fig. S5 from Zhu et al., 2020
defense response to virus increased efficacy, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Zhu et al., 2020
whole organism decreased life span, ameliorated	prmt7^ihbp7/ihbp7 (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Zhu et al., 2020
whole organism ifnphi1 expression increased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Zhu et al., 2020
hepatocyte vacuolated, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by injection: Viruses	Fig. S6 from Zhu et al., 2020
whole organism decreased life span, ameliorated	prmt7^ihbp7/ihbp7 (AB)	viral treatment by exposure to environment: Viruses	Fig. S5 from Zhu et al., 2020
liver ifnphi1 expression increased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by injection: Sprivivirus cyprinus	Fig. 8 from Zhu et al., 2020
defense response to virus increased efficacy, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by injection: Viruses	Fig. S6 from Zhu et al., 2020
liver mxc expression increased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by injection: Viruses	Fig. S6 from Zhu et al., 2020
liver pkz expression increased amount, abnormal	prmt7^ihbp7/ihbp7 (AB)	viral treatment by injection: Viruses	Fig. S6 from Zhu et al., 2020

Citations