CRISPR

CRISPR1-alx1

ID
ZDB-CRISPR-181010-1
Name
CRISPR1-alx1
Previous Names
None
Target
Sequence
5' - GGAGAGCAGCCTGCACGCGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
co3002 alx1
uw2016 alx1
Expression
Gene expression in Wild Types + CRISPR1-alx1
No data available
Phenotype
Phenotype resulting from CRISPR1-alx1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-alx1
Phenotype Fish Conditions Figures
eye morphology, abnormal alx1uw2016/uw2016 control Fig. 1 with imageFig. 8 with image from Yoon et al., 2022
chondrocranium morphology, abnormal alx1uw2016/uw2016 chemical treatment by environment: ethanol Fig. 8 with image from Yoon et al., 2022
chondrocranium morphology, abnormal alx1uw2016/uw2016 control Fig. 8 with image from Yoon et al., 2022
eye morphology, abnormal alx1uw2016/uw2016 chemical treatment by environment: ethanol Fig. 8 with image from Yoon et al., 2022
lens capsule structure, abnormal alx1uw2016/uw2016 standard conditions Fig. 1 with image from Yoon et al., 2022
annular ligament absent, abnormal alx1uw2016/uw2016 standard conditions Fig. 1 with image from Yoon et al., 2022
lens absent, abnormal alx1uw2016/uw2016 standard conditions Fig. 1 with image from Yoon et al., 2022
eye col2a1a expression absent, abnormal alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
eye nucleate erythrocyte increased distribution, abnormal alx1uw2016/uw2016 standard conditions Fig. 3 with image from Yoon et al., 2022
chondrocranium cartilage chondrocyte cuboid, abnormal alx1uw2016/uw2016 (NHGRI-1) standard conditions Fig. 6 with image from Pini et al., 2020
whole organism alx3 expression increased amount, abnormal alx1uw2016/uw2016 (NHGRI-1) standard conditions Fig. 6 with image from Pini et al., 2020
embryonic neurocranium morphogenesis process quality, abnormal alx1uw2016/uw2016 (NHGRI-1) standard conditions Fig. 6 with image from Pini et al., 2020
Meckel's cartilage decreased size, abnormal alx1uw2016/uw2016 (NHGRI-1) standard conditions Fig. 6 with image from Pini et al., 2020
whole organism alx4a expression increased amount, abnormal alx1uw2016/uw2016 (NHGRI-1) standard conditions Fig. 6 with image from Pini et al., 2020
whole organism alx1 expression decreased amount, abnormal alx1uw2016/uw2016 (NHGRI-1) standard conditions Fig. 6 with image from Pini et al., 2020
ethmoid cartilage morphology, abnormal alx1uw2016/uw2016 (NHGRI-1) standard conditions Fig. 6 with image from Pini et al., 2020
ethmoid cartilage decreased size, abnormal alx1uw2016/uw2016 (NHGRI-1) standard conditions Fig. 6 with image from Pini et al., 2020
chondrocranium cartilage morphology, abnormal alx1uw2016/uw2016 (NHGRI-1) standard conditions Fig. 6 with image from Pini et al., 2020
chondrocranium morphology, abnormal alx1uw2016/+ chemical treatment by environment: ethanol Fig. 8 with image from Yoon et al., 2022
chondrocranium morphology, abnormal alx1uw2016/+ control Fig. 8 with image from Yoon et al., 2022
chondrocranium neural crest cell migration decreased process quality, abnormal alx1uw2016/uw2016; zf393Tg + CRISPR3-alx3 control Fig. 6 with image from Yoon et al., 2022
ethmoid cartilage col2a1a expression absent, abnormal alx3uw2113/+; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
eye nucleate erythrocyte increased distribution, abnormal alx3uw2113/+; alx1uw2016/uw2016 standard conditions Fig. 3 with image from Yoon et al., 2022
eye morphology, abnormal alx3uw2113/+; alx1uw2016/uw2016 standard conditions Fig. 3 with image from Yoon et al., 2022
lateral ethmoid decreased size, abnormal alx3uw2113/+; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
ethmoid cartilage absent, abnormal alx3uw2113/+; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
eye col2a1a expression absent, abnormal alx3uw2113/+; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
ethmoid cartilage decreased size, abnormal alx3uw2113/+; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
lateral ethmoid absent, abnormal alx3uw2113/+; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
ventral mandibular arch protruding, abnormal alx3uw2113/+; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
chondrocranium shortened, abnormal alx3uw2113/+; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
chondrocranium col2a1a expression decreased distribution, abnormal alx3uw2113/+; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
ethmoid cartilage col2a1a expression absent, abnormal alx3uw2113/uw2113; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
eye morphology, abnormal alx3uw2113/uw2113; alx1uw2016/uw2016 standard conditions Fig. 3 with image from Yoon et al., 2022
eye nucleate erythrocyte increased distribution, abnormal alx3uw2113/uw2113; alx1uw2016/uw2016 standard conditions Fig. 3 with image from Yoon et al., 2022
ethmoid cartilage absent, abnormal alx3uw2113/uw2113; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
lateral ethmoid decreased size, abnormal alx3uw2113/uw2113; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
eye col2a1a expression absent, abnormal alx3uw2113/uw2113; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
ethmoid cartilage decreased size, abnormal alx3uw2113/uw2113; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
lateral ethmoid absent, abnormal alx3uw2113/uw2113; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
ventral mandibular arch protruding, abnormal alx3uw2113/uw2113; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
chondrocranium shortened, abnormal alx3uw2113/uw2113; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
chondrocranium col2a1a expression decreased distribution, abnormal alx3uw2113/uw2113; alx1uw2016/uw2016 standard conditions Fig. 2 with image from Yoon et al., 2022
Citations