CRISPR

CRISPR1-alkal2b

ID
ZDB-CRISPR-180813-3
Name
CRISPR1-alkal2b
Previous Names
None
Target
Sequence
5' - GGAGCCCTATGAAGACAGGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
t615B alkal2b
Expression
Gene expression in Wild Types + CRISPR1-alkal2b
No data available
Phenotype
Phenotype resulting from CRISPR1-alkal2b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-alkal2b
Phenotype Fish Conditions Figures
opercular flap iridophore decreased amount, abnormal alkal1t613A/t613A; alkal2bt615B/t615B standard conditions Fig. 4 with image from Fadeev et al., 2018
opercular flap has fewer parts of type iridophore, abnormal alkal1t613A/t613A; alkal2bt615B/t615B standard conditions Fig. 4 with image from Fadeev et al., 2018
eye has fewer parts of type iridophore, abnormal alkal1t613A/t613A; alkal2bt615B/t615B standard conditions Fig. 4 with image from Fadeev et al., 2018
eye iridophore decreased amount, abnormal alkal1t613A/t613A; alkal2bt615B/t615B standard conditions Fig. 4 with image from Fadeev et al., 2018
iridophore decreased amount, abnormal alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe irregular spatial pattern, abnormal alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe morphology, abnormal alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
iridophore decreased amount, abnormal alkal1t613A/+; alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe morphology, abnormal alkal1t613A/+; alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe irregular spatial pattern, abnormal alkal1t613A/+; alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe irregular spatial pattern, abnormal alkal1t613A/t613A; alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
iridophore decreased amount, abnormal alkal1t613A/t613A; alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe morphology, abnormal alkal1t613A/t613A; alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
opercular flap has fewer parts of type iridophore, abnormal alkal1t613A/t613A; alkal2bt615B/t615B; alkal2at614A/+ standard conditions Fig. 4 with image from Fadeev et al., 2018
opercular flap iridophore decreased amount, abnormal alkal1t613A/t613A; alkal2bt615B/t615B; alkal2at614A/+ standard conditions Fig. 4 with image from Fadeev et al., 2018
eye iridophore decreased amount, abnormal alkal1t613A/t613A; alkal2bt615B/t615B; alkal2at614A/+ standard conditions Fig. 4 with image from Fadeev et al., 2018
eye has fewer parts of type iridophore, abnormal alkal1t613A/t613A; alkal2bt615B/t615B; alkal2at614A/+ standard conditions Fig. 4 with image from Fadeev et al., 2018
whole organism dead, abnormal alkal1t613A/t613A; alkal2bt615B/t615B; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
whole organism lacks all parts of type iridophore, abnormal alkal1t613A/t613A; alkal2bt615B/t615B; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
Citations