CRISPR

CRISPR1-alkal2a

ID
ZDB-CRISPR-180813-2
Name
CRISPR1-alkal2a
Previous Names
None
Target
Sequence
5' - GGACACGCACCATCTCAAAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
t614A alkal2a
Expression
Gene expression in Wild Types + CRISPR1-alkal2a
No data available
Phenotype
Phenotype resulting from CRISPR1-alkal2a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-alkal2a
Phenotype Fish Conditions Figures
melanophore stripe morphology, abnormal alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
iridophore decreased amount, abnormal alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe irregular spatial pattern, abnormal alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
opercular flap iridophore decreased amount, abnormal alkal1t613A/t613A; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
opercular flap has fewer parts of type iridophore, abnormal alkal1t613A/t613A; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
iridophore decreased amount, abnormal alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe irregular spatial pattern, abnormal alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe morphology, abnormal alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
iridophore decreased amount, abnormal alkal1t613A/+; alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe morphology, abnormal alkal1t613A/+; alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe irregular spatial pattern, abnormal alkal1t613A/+; alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe irregular spatial pattern, abnormal alkal1t613A/t613A; alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
iridophore decreased amount, abnormal alkal1t613A/t613A; alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
melanophore stripe morphology, abnormal alkal1t613A/t613A; alkal2bt615B/+; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
opercular flap has fewer parts of type iridophore, abnormal alkal1t613A/t613A; alkal2bt615B/t615B; alkal2at614A/+ standard conditions Fig. 4 with image from Fadeev et al., 2018
opercular flap iridophore decreased amount, abnormal alkal1t613A/t613A; alkal2bt615B/t615B; alkal2at614A/+ standard conditions Fig. 4 with image from Fadeev et al., 2018
eye iridophore decreased amount, abnormal alkal1t613A/t613A; alkal2bt615B/t615B; alkal2at614A/+ standard conditions Fig. 4 with image from Fadeev et al., 2018
eye has fewer parts of type iridophore, abnormal alkal1t613A/t613A; alkal2bt615B/t615B; alkal2at614A/+ standard conditions Fig. 4 with image from Fadeev et al., 2018
whole organism dead, abnormal alkal1t613A/t613A; alkal2bt615B/t615B; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
whole organism lacks all parts of type iridophore, abnormal alkal1t613A/t613A; alkal2bt615B/t615B; alkal2at614A/t614A standard conditions Fig. 4 with image from Fadeev et al., 2018
Citations