CRISPR

CRISPR2-mir223

ID
ZDB-CRISPR-180706-2
Name
CRISPR2-mir223
Previous Names
None
Target
Sequence
5' - TTTGTCAAATACCCCAAGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
pu18 mir223
Expression
Gene expression in Wild Types + CRISPR2-mir223
No data available
Phenotype
Phenotype resulting from CRISPR2-mir223
No data available
Phenotype of all Fish created by or utilizing CRISPR2-mir223
Phenotype Fish Conditions Figures
whole organism cul1a expression increased amount, abnormal mir223pu18/pu18 transection: caudal fin Fig. 3 from Zhou et al., 2018
neutrophil chemotaxis process efficacy, ameliorated mir223pu18/pu18 transection: caudal fin, chemical treatment: NF-kappaB inhibitor Fig. 3 from Zhou et al., 2018
whole organism traf6 expression increased amount, abnormal mir223pu18/pu18 transection: caudal fin Fig. 3 from Zhou et al., 2018
neutrophil chemotaxis increased efficacy, abnormal mir223pu18/pu18 transection: caudal fin Fig. 1 with imageFig. 2 with imageFig. 3 from Zhou et al., 2018
caudal fin neutrophil increased amount, exacerbated mir223pu18/pu18 transection: caudal fin Fig. 1 with imageFig. 2 with imageFig. 3 from Zhou et al., 2018
fin regeneration increased efficacy, abnormal mir223pu18/pu18 transection: caudal fin Fig. 6 with image from Zhou et al., 2018
caudal fin neutrophil increased amount, ameliorated mir223pu18/pu18 transection: caudal fin, chemical treatment: NF-kappaB inhibitor Fig. 3 from Zhou et al., 2018
regenerating fin increased length, abnormal mir223pu18/pu18 transection: caudal fin Fig. 6 with image from Zhou et al., 2018
caudal fin canonical NF-kappaB signal transduction increased process quality, abnormal mir223pu18/pu18; nc1Tg control Fig. 4 with image from Zhou et al., 2018
caudal fin EGFP expression increased amount, abnormal mir223pu18/pu18; nc1Tg control Fig. 4 with image from Zhou et al., 2018
caudal fin canonical NF-kappaB signal transduction increased process quality, abnormal mir223pu18/pu18; nc1Tg transection: caudal fin Fig. 4 with image from Zhou et al., 2018
caudal fin EGFP expression increased amount, abnormal mir223pu18/pu18; nc1Tg transection: caudal fin Fig. 4 with image from Zhou et al., 2018
neutrophil chemotaxis process efficacy, ameliorated mir223pu18/pu18 + CRISPR7-myd88 + CRISPR8-myd88 transection: caudal fin Fig. 3 from Zhou et al., 2018
caudal fin neutrophil increased amount, ameliorated mir223pu18/pu18 + CRISPR7-myd88 + CRISPR8-myd88 transection: caudal fin Fig. 3 from Zhou et al., 2018
caudal fin neutrophil increased amount, ameliorated mir223pu18/pu18 + CRISPR1-cul1a + CRISPR1-cul1b + CRISPR2-cul1a + CRISPR2-cul1b transection: caudal fin Fig. 3 from Zhou et al., 2018
neutrophil chemotaxis process efficacy, ameliorated mir223pu18/pu18 + CRISPR1-cul1a + CRISPR1-cul1b + CRISPR2-cul1a + CRISPR2-cul1b transection: caudal fin Fig. 3 from Zhou et al., 2018
caudal fin neutrophil increased amount, ameliorated mir223pu18/pu18; pu9Tg transection: caudal fin Fig. 2 with image from Zhou et al., 2018
neutrophil chemotaxis process efficacy, ameliorated mir223pu18/pu18; pu9Tg transection: caudal fin Fig. 2 with image from Zhou et al., 2018
caudal fin EGFP expression amount, ameliorated mir223pu18/pu18; nc1Tg + MO1-rac2 + MO1-spi1b transection: caudal fin Fig. 4 with image from Zhou et al., 2018
caudal fin canonical NF-kappaB signal transduction process quality, ameliorated mir223pu18/pu18; nc1Tg + MO1-rac2 + MO1-spi1b transection: caudal fin Fig. 4 with image from Zhou et al., 2018
Citations