CRISPR

CRISPR1-marcksb

ID
ZDB-CRISPR-180302-1
Name
CRISPR1-marcksb
Previous Names
None
Target
Sequence
5' - GGAGCACAAATCTCCAAAAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb199 marcksb
ihb200 marcksb
Expression
Gene expression in Wild Types + CRISPR1-marcksb
No data available
Phenotype
Phenotype resulting from CRISPR1-marcksb
No data available
Phenotype of all Fish created by or utilizing CRISPR1-marcksb
Phenotype Fish Conditions Figures
whole organism ved expression increased amount, abnormal marcksbihb199/ihb199 standard conditions Fig. S5 from Ye et al., 2019
whole organism ventral region Ab13-smad labeling increased amount, abnormal marcksbihb199/ihb199 standard conditions Fig 6 with image from Ye et al., 2019
whole organism hsp70.3 expression increased amount, abnormal marcksbihb199/ihb199 standard conditions Fig 7 with image from Ye et al., 2019
yolk protruding out of yolk, abnormal marcksbihb199/ihb199 standard conditions Fig 5 with image from Ye et al., 2019
whole organism marcksl1b expression increased amount, abnormal marcksbihb199/ihb199 standard conditions Fig 7 with image from Ye et al., 2019
whole organism ventral region ved expression increased distribution, abnormal marcksbihb199/ihb199 standard conditions Fig 6 with image from Ye et al., 2019
whole organism szl expression increased amount, abnormal marcksbihb199/ihb199 standard conditions Fig. S5 from Ye et al., 2019
whole organism marcksb expression decreased amount, abnormal marcksbihb199/ihb199 standard conditions Fig 5 with image,  Fig 7 with image from Ye et al., 2019
epiboly involved in gastrulation with mouth forming second process quality, abnormal marcksbihb199/ihb199 standard conditions Fig 5 with image from Ye et al., 2019
whole organism marcksl1a expression increased amount, abnormal marcksbihb199/ihb199 standard conditions Fig 7 with image from Ye et al., 2019
whole organism ventral region szl expression increased distribution, abnormal marcksbihb199/ihb199 standard conditions Fig 6 with image from Ye et al., 2019
whole organism ventral region szl expression increased distribution, abnormal marcksbihb199/ihb199 + MO1-marcksb standard conditions Fig 6 with image from Ye et al., 2019
whole organism ventral region ved expression increased distribution, abnormal marcksbihb199/ihb199 + MO1-marcksb standard conditions Fig 6 with image from Ye et al., 2019
whole organism hsp70.3 expression increased amount, abnormal marcksbihb199 standard conditions Fig 7 with image from Ye et al., 2019
whole organism marcksl1a expression increased amount, abnormal marcksbihb199 standard conditions Fig 7 with image from Ye et al., 2019
whole organism marcksb expression decreased amount, abnormal marcksbihb199 standard conditions Fig 7 with image from Ye et al., 2019
whole organism szl expression decreased amount, abnormal marcksbihb199/ihb199 + CRISPR2-hsp70l standard conditions Fig. S5 from Ye et al., 2019
whole organism ved expression decreased amount, abnormal marcksbihb199/ihb199 + CRISPR2-hsp70l standard conditions Fig. S5 from Ye et al., 2019
whole organism ventral region szl expression increased distribution, abnormal marcksbihb199/ihb199 + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
whole organism ventral region ved expression increased distribution, abnormal marcksbihb199/ihb199 + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
whole organism ventralized, exacerbated marcksbihb199/ihb199 + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal marcksbihb199/ihb199 + MO1-hsp70.3 standard conditions Fig 7 with image from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal marcksbihb199/ihb199 + MO1-hsp70.3 standard conditions Fig 7 with image from Ye et al., 2019
whole organism szl expression decreased amount, abnormal marcksbihb199/ihb199 + CRISPR1-marcksa + CRISPR1-marcksl1a + CRISPR1-marcksl1b standard conditions Fig. S5 from Ye et al., 2019
whole organism ved expression decreased amount, abnormal marcksbihb199/ihb199 + CRISPR1-marcksa + CRISPR1-marcksl1a + CRISPR1-marcksl1b standard conditions Fig. S5 from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal marcksbihb199/ihb199 + MO1-marcksa + MO1-marcksl1a + MO2-marcksl1b standard conditions Fig 7 with image from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal marcksbihb199/ihb199 + MO1-marcksa + MO1-marcksl1a + MO2-marcksl1b standard conditions Fig 7 with image from Ye et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.