CRISPR

CRISPR1-klf6a

ID

ZDB-CRISPR-171018-1

Name

CRISPR1-klf6a

Previous Names

None

Target

klf6a (1)

Sequence

5' - GCTTGAAGAATACTGGCAAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ioz102	klf6a

Expression

Gene expression in Wild Types + CRISPR1-klf6a

No data available

Phenotype

Phenotype resulting from CRISPR1-klf6a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-klf6a

Phenotype	Fish	Conditions	Figures
hematopoietic stem cell myb expression decreased amount, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 2 from Xue et al., 2017
hematopoietic stem cell myb expression decreased distribution, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 2 from Xue et al., 2017
whole organism posterior region hbae1.1 expression decreased amount, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 2 from Xue et al., 2017
whole organism posterior region spi1b expression decreased amount, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 2 from Xue et al., 2017
hematopoietic stem cell gata1a expression decreased distribution, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 2 from Xue et al., 2017
intermediate cell mass of mesoderm posterior region ccl25b expression decreased amount, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 5 from Xue et al., 2017
hematopoietic stem cell lyz expression decreased distribution, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 2 from Xue et al., 2017
hematopoietic stem cell gata1a expression decreased amount, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 2 from Xue et al., 2017
hematopoietic stem cell lyz expression decreased amount, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 2 from Xue et al., 2017
caudal hematopoietic tissue hematopoietic stem cell proliferation decreased occurrence, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 3 from Xue et al., 2017
whole organism posterior region ccl25b expression decreased amount, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 5 from Xue et al., 2017
whole organism klf6a expression decreased amount, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 2 from Xue et al., 2017
whole organism posterior region myb expression decreased amount, abnormal	klf6a^{ioz102/ioz102}	standard conditions	Fig. 2 from Xue et al., 2017
hematopoietic stem cell migration decreased occurrence, abnormal	klf6a^{ioz102/ioz102}; ioz1Tg; s896Tg	standard conditions	Fig. 2 from Xue et al., 2017
caudal vein plexus hematopoietic stem cell decreased amount, abnormal	klf6a^{ioz102/ioz102}; ioz1Tg; s896Tg	standard conditions	Fig. 2 from Xue et al., 2017
brain vasculature hemorrhagic, abnormal	klf6a^{ioz102/ioz102}; s843Tg; sd2Tg	standard conditions	Fig. 2 from Xue et al., 2017
caudal vein plexus decreased volume, abnormal	klf6a^{ioz102/ioz102}; s843Tg; sd2Tg	standard conditions	Fig. 2 from Xue et al., 2017
caudal vein plexus decreased thickness, abnormal	klf6a^{ioz102/ioz102}; s843Tg; sd2Tg	standard conditions	Fig. 2 from Xue et al., 2017
caudal vein plexus disorganized, abnormal	klf6a^{ioz102/ioz102}; s843Tg; sd2Tg	standard conditions	Fig. 2 from Xue et al., 2017

Citations