CRISPR

CRISPR2-twist2

ID

ZDB-CRISPR-170918-15

Name

CRISPR2-twist2

Previous Names

twist2-2 (1)

Target

twist2 (1)

Sequence

5' - GCCGCTCGCGTACGTTCGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf2114	twist2
zf2115	twist2
zf3421	twist2

Expression

Gene expression in Wild Types + CRISPR2-twist2

No data available

Phenotype

Phenotype resulting from CRISPR2-twist2

No data available

Phenotype of all Fish created by or utilizing CRISPR2-twist2

Phenotype	Fish	Conditions	Figures
caudal fin shortened, abnormal	twist2^{zf2114/zf2114}	standard conditions	Fig. 3 from Qin et al., 2018
spinal cord bent, abnormal	twist2^{zf2114/zf2114}	standard conditions	Fig. 3 from Qin et al., 2018
caudal fin shortened, abnormal	twist2^{zf2115/zf2115}	standard conditions	Fig. 3 from Qin et al., 2018
spinal cord bent, abnormal	twist2^{zf2115/zf2115}	standard conditions	Fig. 3 from Qin et al., 2018
whole organism tnfa expression increased amount, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
whole organism oscp1a expression decreased amount, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
whole organism sp7 expression decreased amount, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
whole organism bmp2a expression decreased amount, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
trunk decreased length, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
post-vent region curved, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
whole organism twist2 expression increased amount, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
whole organism col1a2 expression decreased amount, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
whole organism dead, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	text only from Zhao et al., 2020
whole organism bmp2b expression decreased amount, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
whole organism il1b expression increased amount, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
whole organism runx2a expression decreased amount, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
whole organism runx2b expression decreased amount, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
whole organism alpl expression decreased amount, abnormal	twist2^{zf3421/zf3421} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
mouth open, abnormal	twist2^zf3421/+ (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
whole organism decreased weight, abnormal	twist2^zf3421/+ (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
mandibular arch skeleton protruding, abnormal	twist2^zf3421/+ (AB)	standard conditions	Fig. 4 from Zhao et al., 2020

Citations