CRISPR

CRISPR1-tpcn2

ID
ZDB-CRISPR-170630-6
Name
CRISPR1-tpcn2
Previous Names
None
Target
Sequence
5' - GGACCCTTCCCGAGATAGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
dhkz1a tpcn2
Expression
Gene expression in Wild Types + CRISPR1-tpcn2
No data available
Phenotype
Phenotype resulting from CRISPR1-tpcn2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tpcn2
Phenotype Fish Conditions Figures
striated muscle cell decreased width, abnormal tpcn2dhkz1a/dhkz1a (AB/TU) standard conditions Fig. 4 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal tpcn2dhkz1a/dhkz1a (AB/TU) standard conditions Fig. 3 with image from Kelu et al., 2017
slow muscle cell decreased amount, abnormal tpcn2dhkz1a/dhkz1a (AB/TU) standard conditions Fig. 4 with image from Kelu et al., 2017
myotome decreased width, abnormal tpcn2dhkz1a/dhkz1a (AB/TU) standard conditions Fig. 3 with imageFig. 4 with image from Kelu et al., 2017
blood cell accumulation heart, abnormal tpcn2dhkz1a/dhkz1a (AB/TU) control Fig. 2 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal tpcn2dhkz1a/dhkz1a (AB/TU) standard conditions Fig. 4 with image from Kelu et al., 2017
head decreased pigmentation, abnormal tpcn2dhkz1a/dhkz1a (AB/TU) control Fig. 2 with image from Kelu et al., 2017
somite U-shaped, abnormal tpcn2dhkz1a/dhkz1a (AB/TU) standard conditions Fig. 3 with imageFig. 4 with image from Kelu et al., 2017
eye decreased pigmentation, abnormal tpcn2dhkz1a/dhkz1a (AB/TU) control Fig. 2 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal tpcn2dhkz1a/dhkz1a (AB/TU) standard conditions Fig. 3 with image from Kelu et al., 2017
trunk decreased pigmentation, abnormal tpcn2dhkz1a/dhkz1a (AB/TU) control Fig. 2 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal tpcn2dhkz1a/+ (AB/TU) standard conditions Fig. 4 with image from Kelu et al., 2017
somite U-shaped, abnormal tpcn2dhkz1a/+ (AB/TU) standard conditions Fig. 3 with imageFig. 4 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal tpcn2dhkz1a/+ (AB/TU) standard conditions Fig. 3 with image from Kelu et al., 2017
myotome decreased width, abnormal tpcn2dhkz1a/+ (AB/TU) standard conditions Fig. 3 with imageFig. 4 with image from Kelu et al., 2017
striated muscle cell decreased width, abnormal tpcn2dhkz1a/+ (AB/TU) standard conditions Fig. 4 with image from Kelu et al., 2017
slow muscle cell decreased amount, abnormal tpcn2dhkz1a/+ (AB/TU) standard conditions Fig. 4 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal tpcn2dhkz1a/+ (AB/TU) standard conditions Fig. 3 with image from Kelu et al., 2017
CaP motoneuron release of sequestered calcium ion into cytosol asynchronous, abnormal tpcn2dhkz1a/dhkz1a; nksaigff213aGt; zf415Tg standard conditions Fig. 1 with image from Kelu et al., 2018
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, abnormal tpcn2dhkz1a/dhkz1a; nksaigff213aGt; zf415Tg standard conditions Fig. 1 with image from Kelu et al., 2018
Citations