CRISPR

CRISPR1-dctn1b

ID

ZDB-CRISPR-170627-3

Name

CRISPR1-dctn1b

Previous Names

None

Target

dctn1b (1)

Sequence

5' - GGCGAGGGCAGCGCTCCCAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nl17	dctn1b

Expression

Gene expression in Wild Types + CRISPR1-dctn1b

No data available

Phenotype

Phenotype resulting from CRISPR1-dctn1b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-dctn1b

Phenotype	Fish	Conditions	Figures
posterior lateral line nerve truncated, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 8 from Drerup et al., 2017
posterior lateral line nerve axon terminus has extra parts of type posterior lateral line nerve mitochondrion, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 8 from Drerup et al., 2017
posterior lateral line nerve retrograde axonal transport decreased occurrence, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 10 from Drerup et al., 2017
posterior lateral line nerve axon terminus Ab1-lamp1 labeling increased amount, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 10 from Drerup et al., 2017
eye decreased size, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 8 from Drerup et al., 2017
posterior lateral line nerve decreased length, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 8 from Drerup et al., 2017
posterior lateral line neuromast axon terminus swollen, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 8 from Drerup et al., 2017
posterior lateral line nerve anterograde axonal transport of mitochondrion decreased occurrence, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 8 from Drerup et al., 2017
posterior lateral line nerve retrograde axonal transport of mitochondrion decreased occurrence, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 8 from Drerup et al., 2017
posterior lateral line neuromast axon terminus Ab1-lamp1 labeling increased amount, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 10 from Drerup et al., 2017
posterior lateral line nerve axon terminus ab15-mapk labeling increased amount, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 10 from Drerup et al., 2017
posterior lateral line nerve axon terminus swollen, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 8 from Drerup et al., 2017
posterior lateral line neuromast axon terminus ab15-mapk labeling increased amount, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 10 from Drerup et al., 2017
posterior lateral line neuromast axon terminus has extra parts of type posterior lateral line neuromast mitochondrion, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 8 from Drerup et al., 2017
eye decreased diameter, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 8 from Drerup et al., 2017
posterior lateral line nerve decreased diameter, abnormal	dctn1a^s309/s309; dctn1b^nl17/nl17; nl1Tg	standard conditions	Fig. 8 from Drerup et al., 2017

Citations