CRISPR

CRISPR1-foxo3b

ID

ZDB-CRISPR-170126-1

Name

CRISPR1-foxo3b

Previous Names

None

Target

foxo3b (1)

Sequence

5' - GGACAACGGCAGCCCAAGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ihb404	foxo3b

Expression

Gene expression in Wild Types + CRISPR1-foxo3b

No data available

Phenotype

Phenotype resulting from CRISPR1-foxo3b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-foxo3b

Phenotype	Fish	Conditions	Figures
whole organism mxc expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 10 from Liu et al., 2016
whole organism vhl expression decreased amount, abnormal	foxo3b^{ihb404/ihb404}	hypoxia	Fig. 8 from Liu et al., 2016
whole organism decreased life span, abnormal	foxo3b^{ihb404/ihb404}	hypoxia	Fig. 11 from Liu et al., 2016
whole organism vhl expression decreased amount, abnormal	foxo3b^{ihb404/ihb404}	standard conditions	Fig. 8 from Liu et al., 2016
whole organism serpine1 expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	hypoxia	Fig. 9 from Liu et al., 2016
whole organism il11a expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	standard conditions	Fig. 9 from Liu et al., 2016
whole organism ifnphi1 expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 10 from Liu et al., 2016
defense response to virus increased process quality, abnormal	foxo3b^{ihb404/ihb404}	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 11 from Liu et al., 2016
whole organism pkz expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 10 from Liu et al., 2016
whole organism pou5f3 expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	standard conditions	Fig. 9 from Liu et al., 2016
whole organism defbl1 expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	chemical treatment by diet: exopolysaccharide, high fat	Fig. 7 from Zhang et al., 2019
whole organism tnfb expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 10 from Liu et al., 2016
whole organism serpine1 expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	standard conditions	Fig. 9 from Liu et al., 2016
whole organism hamp expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	chemical treatment by diet: exopolysaccharide, high fat	Fig. 7 from Zhang et al., 2019
whole organism il11a expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	hypoxia	Fig. 9 from Liu et al., 2016
response to hypoxia disrupted, abnormal	foxo3b^{ihb404/ihb404}	hypoxia	Fig. 11 from Liu et al., 2016
whole organism pou5f3 expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	hypoxia	Fig. 9 from Liu et al., 2016
whole organism vegfaa expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	standard conditions	Fig. 9 from Liu et al., 2016
whole organism life span, ameliorated	foxo3b^{ihb404/ihb404}	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 11 from Liu et al., 2016
whole organism defbl2 expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	chemical treatment by diet: exopolysaccharide, high fat	Fig. 7 from Zhang et al., 2019
whole organism vegfaa expression increased amount, abnormal	foxo3b^{ihb404/ihb404}	hypoxia	Fig. 9 from Liu et al., 2016
motor neuron axon decreased length, abnormal	magoh^oz37/oz37; foxo3b^ihb404/+	standard conditions	Fig 8 from Gangras et al., 2020
motor neuron axon decreased length, ameliorated	magoh^oz37/oz37; foxo3b^{ihb404/ihb404}	standard conditions	Fig 8 from Gangras et al., 2020

Citations