CRISPR

CRISPR5-th

ID

ZDB-CRISPR-170106-2

Name

CRISPR5-th

Previous Names

None

Target

th (1)

Sequence

5' - GGGTTGTTACACTCATAAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets within an intron of th.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ion27dTg	th
ion32Tg	th
m1512Tg	th
m1513Tg	th
m1514Tg	th

Expression

Gene expression in Wild Types + CRISPR5-th

No data available

Phenotype

Phenotype resulting from CRISPR5-th

No data available

Phenotype of all Fish created by or utilizing CRISPR5-th

Phenotype	Fish	Conditions	Figures
dopaminergic neuron mitochondrial mRNA surveillance decreased process quality, abnormal	th^{ion32Tg/ion32Tg}; pt420Tg/pt420Tg	chemical treatment by environment: metronidazole	Figure 1 from Kim et al., 2021
dopaminergic neuron mitochondrion GFP expression spatial pattern, abnormal	th^{ion32Tg/ion32Tg}; pt420Tg/pt420Tg	chemical treatment by environment: metronidazole	Figure 1 from Kim et al., 2021
dopaminergic neuron mitochondrion decreased amount, abnormal	th^{ion32Tg/ion32Tg}; pt420Tg/pt420Tg	chemical treatment by environment: metronidazole	Figure 1 from Kim et al., 2021
dopaminergic neuron mitochondrion decreased speed, abnormal	th^{ion32Tg/ion32Tg}; pt420Tg/pt420Tg	chemical treatment by environment: metronidazole	Figure 1 from Kim et al., 2021
dopaminergic neuron mitochondrion movement quality, abnormal	th^{ion32Tg/ion32Tg}; pt420Tg/pt420Tg	chemical treatment by environment: metronidazole	Figure 1 from Kim et al., 2021
dopaminergic neuron mitochondrion increased length, abnormal	th^{ion32Tg/ion32Tg}; pt420Tg/pt420Tg	chemical treatment by environment: metronidazole	Figure 1 from Kim et al., 2021
dopaminergic neuron ribonucleotide biosynthetic process normal frequency, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole, chemical treatment by environment: olmesartan	Figure 5 from Kim et al., 2021
dopaminergic neuron ATP metabolic process normal frequency, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: L-dopa, chemical treatment by environment: olmesartan	Figure 5 from Kim et al., 2021
locomotion decreased process quality, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: L-dopa, chemical treatment by environment: metronidazole	Figure 2 from Kim et al., 2021
dopaminergic neuron inorganic cation transmembrane transport normal frequency, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: L-dopa, chemical treatment by environment: olmesartan	Figure 5 from Kim et al., 2021
dopaminergic neuron respiratory electron transport chain increased frequency, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole	Figure 5 from Kim et al., 2021
forebrain dopaminergic neuron atp6ap2 expression increased amount, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole	Figure 5 from Kim et al., 2021
dopaminergic neuron respiratory electron transport chain normal frequency, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: L-dopa, chemical treatment by environment: olmesartan	Figure 5 from Kim et al., 2021
dopaminergic neuron oxidative phosphorylation increased frequency, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: conduritol B epoxide	Figure 5 from Kim et al., 2021
dopaminergic neuron ribonucleotide biosynthetic process normal frequency, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: L-dopa, chemical treatment by environment: olmesartan	Figure 5 from Kim et al., 2021
dopaminergic neuron ATP metabolic process normal frequency, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole, chemical treatment by environment: olmesartan	Figure 5 from Kim et al., 2021
dopaminergic neuron oxidative phosphorylation normal frequency, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole, chemical treatment by environment: olmesartan	Figure 5 from Kim et al., 2021
forebrain dopaminergic neuron semi-viable, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole	Figure 3 from Kim et al., 2021
dopaminergic neuron ribonucleotide biosynthetic process increased frequency, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole	Figure 5 from Kim et al., 2021
dopaminergic neuron respiratory electron transport chain increased frequency, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: conduritol B epoxide	Figure 5 from Kim et al., 2021
forebrain dopaminergic neuron atp6ap2 expression increased amount, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: conduritol B epoxide	Figure 5 from Kim et al., 2021
dopaminergic neuron oxidative phosphorylation increased frequency, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole	Figure 5 from Kim et al., 2021
dopaminergic neuron ATP metabolic process increased frequency, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: conduritol B epoxide	Figure 5 from Kim et al., 2021
dopaminergic neuron ribonucleotide biosynthetic process increased frequency, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: conduritol B epoxide	Figure 5 from Kim et al., 2021
dopaminergic neuron oxidative phosphorylation normal frequency, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: L-dopa, chemical treatment by environment: olmesartan	Figure 5 from Kim et al., 2021
dopaminergic neuron ATP metabolic process increased frequency, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole	Figure 5 from Kim et al., 2021
dopaminergic neuron inorganic ion transmembrane transport increased frequency, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole	Figure 5 from Kim et al., 2021
dopaminergic neuron inorganic cation transmembrane transport normal frequency, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole, chemical treatment by environment: olmesartan	Figure 5 from Kim et al., 2021
dopaminergic neuron respiratory electron transport chain normal frequency, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole, chemical treatment by environment: olmesartan	Figure 5 from Kim et al., 2021
locomotion decreased process quality, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole, chemical treatment by environment: olmesartan	Figure 2 from Kim et al., 2021
dopaminergic neuron inorganic ion transmembrane transport increased frequency, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: conduritol B epoxide	Figure 5 from Kim et al., 2021
locomotion decreased process quality, abnormal	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg	chemical treatment by environment: metronidazole	Figure 2 from Kim et al., 2021
forebrain dopaminergic neuron semi-viable, ameliorated	th^{ion32Tg/ion32Tg}; c264Tg/c264Tg + CRISPR1-agtr1a + CRISPR2-agtr1b	chemical treatment by environment: metronidazole	Figure 3 from Kim et al., 2021

Citations