CRISPR

CRISPR1-tapt1b

ID

ZDB-CRISPR-161026-1

Name

CRISPR1-tapt1b

Previous Names

None

Target

tapt1b (1)

Sequence

5' - GACAGTGTGTCCAGGAGGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
cmg6	tapt1b

Expression

Gene expression in Wild Types + CRISPR1-tapt1b

No data available

Phenotype

Phenotype resulting from CRISPR1-tapt1b

Phenotype	Fish	Figures
ceratobranchial cartilage disorganized, abnormal	AB + CRISPR1-tapt1b	Fig. S13 from Symoens et al., 2015
ceratobranchial cartilage chondrocyte absent, abnormal	hu5910Tg + CRISPR1-tapt1b	Fig. S13 from Symoens et al., 2015
ceratohyal cartilage disorganized, abnormal	AB + CRISPR1-tapt1b	Fig. S13 from Symoens et al., 2015
cranial cartilage malformed, abnormal	AB + CRISPR1-tapt1b	Fig. S13 from Symoens et al., 2015
cranial neural crest cell decreased amount, abnormal	y1Tg + CRISPR1-tapt1b	Fig. S13 from Symoens et al., 2015
cranial neural crest cell disorganized, abnormal	y1Tg + CRISPR1-tapt1b	Fig. S13 from Symoens et al., 2015
splanchnocranium immature, abnormal	AB + CRISPR1-tapt1b	Fig. S13 from Symoens et al., 2015

Phenotype of all Fish created by or utilizing CRISPR1-tapt1b

Phenotype	Fish	Conditions	Figures
eye melanocyte spatial pattern, abnormal	tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. S4 from Jarayseh et al., 2023
eye iridophore spatial pattern, abnormal	tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. S4 from Jarayseh et al., 2023
cranial cartilage malformed, abnormal	AB + CRISPR1-tapt1b	standard conditions	Fig. S13 from Symoens et al., 2015
ceratobranchial cartilage disorganized, abnormal	AB + CRISPR1-tapt1b	standard conditions	Fig. S13 from Symoens et al., 2015
ceratohyal cartilage disorganized, abnormal	AB + CRISPR1-tapt1b	standard conditions	Fig. S13 from Symoens et al., 2015
splanchnocranium immature, abnormal	AB + CRISPR1-tapt1b	standard conditions	Fig. S13 from Symoens et al., 2015
ceratobranchial cartilage chondrocyte absent, abnormal	hu5910Tg + CRISPR1-tapt1b	standard conditions	Fig. S13 from Symoens et al., 2015
cranial neural crest cell decreased amount, abnormal	y1Tg + CRISPR1-tapt1b	standard conditions	Fig. S13 from Symoens et al., 2015
cranial neural crest cell disorganized, abnormal	y1Tg + CRISPR1-tapt1b	standard conditions	Fig. S13 from Symoens et al., 2015
whole organism increased length, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 2 from Jarayseh et al., 2023
kidney dorsal side increased pigmentation, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 2 from Jarayseh et al., 2023
ciliary marginal zone ventral side decreased size, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
swimming behavior process quality, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 5 from Jarayseh et al., 2023
oral cavity dorsal side increased pigmentation, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 2 from Jarayseh et al., 2023
swim bladder dorsal side increased pigmentation, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 2 from Jarayseh et al., 2023
retina increased thickness, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
anterior chamber eye collapsed, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
retinal inner plexiform layer inclusion body present, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
retinal ganglion cell layer hyperplastic, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
pupil decreased area, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 3 from Jarayseh et al., 2023
dorsal aorta dorsal side increased pigmentation, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 2 from Jarayseh et al., 2023
retinal ganglion cell layer increased thickness, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
eye melanocyte spatial pattern, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 2 from Jarayseh et al., 2023
ciliary marginal zone dorsal side decreased size, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
lens capsule delaminated, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
photoreceptor outer segment layer degenerate, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
retinal inner plexiform layer increased thickness, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
lens decreased size, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
whole organism opn1mw2 expression increased amount, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 7 from Jarayseh et al., 2023
whole organism mipa expression decreased amount, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 7 from Jarayseh et al., 2023
whole organism timp2b expression increased amount, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 7 from Jarayseh et al., 2023
retinal inner plexiform layer hyperplastic, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
integument increased pigmentation, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 2 from Jarayseh et al., 2023
whole organism cryaa expression decreased amount, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 7 from Jarayseh et al., 2023
whole organism dead, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. S2 from Jarayseh et al., 2023
lens cell mislocalised, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
whole organism crygn1 expression decreased amount, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 7 from Jarayseh et al., 2023
eye iridophore spatial pattern, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 2 from Jarayseh et al., 2023
anterior chamber eye opacity, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
vitreous absence of anatomical entity, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
retinal pigmented epithelium low brightness, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
eye decreased area, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 3 from Jarayseh et al., 2023
lens position, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 4 from Jarayseh et al., 2023
pupil decreased ratio eye, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 3 from Jarayseh et al., 2023
optokinetic behavior decreased process quality, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 5 from Jarayseh et al., 2023
whole organism col2a1a expression increased amount, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 7 from Jarayseh et al., 2023
whole organism rom1a expression decreased amount, abnormal	tapt1a^cmg3/cmg3; tapt1b^cmg6/cmg6 (AB)	standard conditions	Fig. 7 from Jarayseh et al., 2023

Citations