CRISPR

CRISPR1-aplnrb

ID

ZDB-CRISPR-151016-2

Name

CRISPR1-aplnrb

Previous Names

None

Target

aplnrb (1)

Sequence

5' - CTACATGCTCATCTTCATCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mu270	aplnrb
mu281	aplnrb

Expression

Gene expression in Wild Types + CRISPR1-aplnrb

No data available

Phenotype

Phenotype resulting from CRISPR1-aplnrb

No data available

Phenotype of all Fish created by or utilizing CRISPR1-aplnrb

Phenotype	Fish	Conditions	Figures
endothelial cell decreased amount, abnormal	aplnrb^mu270/mu270	standard conditions	Fig. S7 from Kwon et al., 2016
pericardium edematous, abnormal	aplnrb^mu270/mu270	standard conditions	Fig. S5 from Kwon et al., 2016
establishment of epithelial cell polarity disrupted, abnormal	aplnrb^mu270/+	standard conditions	Fig. S5 from Kwon et al., 2016
endothelial cell decreased amount, abnormal	aplnrb^mu270/+	standard conditions	Fig. S7 from Kwon et al., 2016
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	aplnrb^mu270/+; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline arrested, abnormal	aplnrb^mu270/mu270; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	aplnrb^mu270/mu270; y1Tg	control	Fig. 2 from Helker et al., 2015
trunk sprouting angiogenesis disrupted, abnormal	aplnrb^mu281/mu281; y1Tg	standard conditions	Figure 4 from Helker et al., 2020
trunk sprouting angiogenesis decreased occurrence, abnormal	aplnrb^mu281/mu281; y1Tg	standard conditions	Figure 4 from Helker et al., 2020
angiogenic sprout decreased length, abnormal	aplnrb^mu281/mu281; y1Tg	standard conditions	Figure 4 from Helker et al., 2020
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	aplnrb^mu270/+; aplnra^mu296/+; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline arrested, abnormal	aplnrb^mu270/+; aplnra^mu296/mu296; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	aplnrb^mu270/+; aplnra^mu296/mu296; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline arrested, abnormal	aplnrb^mu270/mu270; aplnra^mu296/+; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	aplnrb^mu270/mu270; aplnra^mu296/+; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline arrested, abnormal	aplnrb^mu270/mu270; aplnra^mu296/mu296; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	aplnrb^mu270/mu270; aplnra^mu296/mu296; y1Tg	control	Fig. 2 from Helker et al., 2015
trunk sprouting angiogenesis decreased occurrence, abnormal	aplnrb^mu281/mu281; aplnra^mu296/mu296; y1Tg	standard conditions	Figure 1 from Helker et al., 2020
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal	aplnrb^mu281/mu281; aplnra^mu296/mu296; y7Tg	standard conditions	Figure 2 from Helker et al., 2020
trunk sprouting angiogenesis disrupted, abnormal	aplnrb^mu281/+; aplnra^mu296/+; fr13Tg	heat shock	Figure 4 from Helker et al., 2020
trunk angiogenic sprout mislocalised, abnormal	aplnrb^mu281/+; aplnra^mu296/+; fr13Tg	heat shock	Figure 4 from Helker et al., 2020
endothelial tip cell filopodium decreased length, abnormal	aplnrb^mu281/mu281; aplnra^mu296/+; mu280Tg	standard conditions	Figure 2 from Helker et al., 2020
trunk sprouting angiogenesis disrupted, abnormal	aplnrb^mu281/mu281; aplnra^mu296/+; mu280Tg	standard conditions	Figure 2 from Helker et al., 2020
endothelial tube lumen extension involved in blood vessel lumen ensheathment delayed, abnormal	aplnrb^mu281/mu281; aplnra^mu296/+; mu280Tg	standard conditions	Figure 2 from Helker et al., 2020
angiogenic sprout decreased length, abnormal	aplnrb^mu281/mu281; aplnra^mu296/+; mu280Tg	standard conditions	Figure 2 from Helker et al., 2020
trunk angiogenic sprout mislocalised, abnormal	aplnrb^mu281/mu281; aplnra^mu296/mu296; fr13Tg	heat shock	Figure 4 from Helker et al., 2020
trunk sprouting angiogenesis disrupted, abnormal	aplnrb^mu281/mu281; aplnra^mu296/mu296; fr13Tg	heat shock	Figure 4 from Helker et al., 2020

Citations