CRISPR

CRISPR1-nsd2

ID

ZDB-CRISPR-140711-4

Name

CRISPR1-nsd2

Previous Names

CRISPR1-whsc1

Target

nsd2 (1)

Sequence

5' - GGAAGCAAGTACCAGCAGAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
scu1	nsd2
zf2077	nsd2
zf2078	nsd2

Expression

Gene expression in Wild Types + CRISPR1-nsd2

No data available

Phenotype

Phenotype resulting from CRISPR1-nsd2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-nsd2

Phenotype	Fish	Conditions	Figures
pleuroperitoneal cavity neoplasm fbp2 expression increased amount, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 6 from Yu et al., 2017
whole organism decreased length, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 3 from Yu et al., 2017
third ventricle increased size, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 2 from Yu et al., 2017
swim bladder absent, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 5 from Yu et al., 2017
cardiac muscle decreased amount, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 2 from Yu et al., 2017
pleuroperitoneal cavity neoplasm cdh1 expression increased amount, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 6 from Yu et al., 2017
whole organism histone H3K36 trimethyltransferase activity decreased occurrence, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 1 from Yu et al., 2017
whole organism wnt5b expression increased amount, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 7 from Yu et al., 2017
swim bladder development disrupted, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 3 from Yu et al., 2017
whole organism tcf3b expression increased amount, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 7 from Yu et al., 2017
whole organism fzd5 expression increased amount, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 7 from Yu et al., 2017
cardiac ventricle dilated, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 2 from Yu et al., 2017
pericardium increased size, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 2 from Yu et al., 2017
swim bladder uninflated, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 3 from Yu et al., 2017
pleuroperitoneal region neoplastic, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 5 , Fig. 6 from Yu et al., 2017
heart increased size, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 2 from Yu et al., 2017
whole organism tcf3a expression increased amount, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 7 from Yu et al., 2017
whole organism hoxc6a expression increased amount, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 7 from Yu et al., 2017
whole organism decreased pigmentation, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 3 from Yu et al., 2017
whole organism histone H3K36 dimethyltransferase activity decreased occurrence, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 1 from Yu et al., 2017
pleuroperitoneal region cell population proliferation increased process quality, abnormal	nsd2^{zf2077/zf2077}	standard conditions	Fig. 6 from Yu et al., 2017
pleuroperitoneal cavity neoplasm fbp2 expression increased amount, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 6 from Yu et al., 2017
whole organism decreased length, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 3 from Yu et al., 2017
third ventricle increased size, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 2 from Yu et al., 2017
cardiac muscle decreased amount, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 2 from Yu et al., 2017
swim bladder absent, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 5 from Yu et al., 2017
pleuroperitoneal cavity neoplasm cdh1 expression increased amount, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 6 from Yu et al., 2017
whole organism histone H3K36 trimethyltransferase activity decreased occurrence, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 1 from Yu et al., 2017
whole organism wnt5b expression increased amount, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 7 from Yu et al., 2017
swim bladder development disrupted, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 3 from Yu et al., 2017
whole organism fzd5 expression increased amount, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 7 from Yu et al., 2017
whole organism tcf3b expression increased amount, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 7 from Yu et al., 2017
cardiac ventricle dilated, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 2 from Yu et al., 2017
heart increased size, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 2 from Yu et al., 2017
pericardium increased size, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 2 from Yu et al., 2017
pleuroperitoneal region neoplastic, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 5 , Fig. 6 from Yu et al., 2017
swim bladder uninflated, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 3 from Yu et al., 2017
whole organism tcf3a expression increased amount, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 7 from Yu et al., 2017
whole organism hoxc6a expression increased amount, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 7 from Yu et al., 2017
whole organism decreased pigmentation, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 3 from Yu et al., 2017
whole organism histone H3K36 dimethyltransferase activity decreased occurrence, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 1 from Yu et al., 2017
pleuroperitoneal region cell population proliferation increased process quality, abnormal	nsd2^{zf2078/zf2078}	standard conditions	Fig. 6 from Yu et al., 2017
motor neuron decreased amount, abnormal	nsd2^{zf2077/zf2077}; zf2076Tg	standard conditions	Fig. 2 from Yu et al., 2017
motor neuron decreased amount, abnormal	nsd2^{zf2078/zf2078}; zf2076Tg	standard conditions	Fig. 2 from Yu et al., 2017

Citations