CRISPR

CRISPR2-ptenb

ID
ZDB-CRISPR-230411-3
Name
CRISPR2-ptenb
Previous Names
None
Target
Sequence
5' - GGGAGTGACTATTCCCAGTCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
Genomic Features
Genomic Feature Affected Genomic Regions
zf3644 ptenb
Expression
Gene expression in Wild Types + CRISPR2-ptenb
No data available
Phenotype
Phenotype resulting from CRISPR2-ptenb
No data available
Phenotype of all Fish created by or utilizing CRISPR2-ptenb
Phenotype Fish Conditions Figures
liver Ab5-glul labeling spatial pattern, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 3 with image from Luo et al., 2021
liver Ab18-pcna labeling decreased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 5 with image from Luo et al., 2021
liver ab5-akt labeling increased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 3 with imageFig. 5 with imageFig. 6 with image from Luo et al., 2021
liver hepatocellular carcinoma increased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 5 with image from Luo et al., 2021
hepatocyte lipid storage decreased process quality, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 3 with image from Luo et al., 2021
liver Ab5-glul labeling increased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 5 with image from Luo et al., 2021
liver Ab18-pcna labeling amount, ameliorated ptenazf3641/zf3641; ptenbzf3644/zf3644 chemical treatment by environment: MK-2206 Fig. 6 with image from Luo et al., 2021
liver hepatocellular carcinoma neoplastic, malignant, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 6 with image from Luo et al., 2021
liver fabp10a expression increased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 3 with image from Luo et al., 2021
liver hepatocellular carcinoma neoplastic, malignant, ameliorated ptenazf3641/zf3641; ptenbzf3644/zf3644 chemical treatment by environment: MK-2206 Fig. 6 with image from Luo et al., 2021
whole organism viability, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 3 with image from Luo et al., 2021
liver ab5-akt labeling amount, ameliorated ptenazf3641/zf3641; ptenbzf3644/zf3644 chemical treatment by environment: MK-2206 Fig. 6 with image from Luo et al., 2021
liver hepatocellular carcinoma proliferative, ameliorated ptenazf3641/zf3641; ptenbzf3644/zf3644 chemical treatment by environment: MK-2206 Fig. 6 with image from Luo et al., 2021
liver Ab18-pcna labeling increased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 3 with imageFig. 5 with image from Luo et al., 2021
liver hepatocellular carcinoma proliferative, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 5 with imageFig. 6 with image from Luo et al., 2021
liver ptenb expression decreased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 3 with image from Luo et al., 2021
liver dysplastic, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 3 with image from Luo et al., 2021
liver Ab5-glul labeling amount, ameliorated ptenazf3641/zf3641; ptenbzf3644/zf3644 chemical treatment by environment: MK-2206 Fig. 6 with image from Luo et al., 2021
liver Ab4-pten labeling spatial pattern, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 2 with image from Luo et al., 2021
liver Ab4-pten labeling decreased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 2 with imageFig. 6 with image from Luo et al., 2021
liver ptena expression decreased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 3 with image from Luo et al., 2021
liver Ab5-akt1 labeling decreased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644 standard conditions Fig. 6 with image from Luo et al., 2021
liver tp53 expression decreased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
vasculature hepatocellular carcinoma neoplastic, invasive, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
liver Ab5-glul labeling increased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with imageFig. 5 with image from Luo et al., 2021
liver ptena expression decreased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
liver hepatocellular carcinoma increased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
liver vasculature dysplastic, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
hepatocyte lipid storage decreased process quality, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
liver hepatocellular carcinoma increased amount, exacerbated ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 5 with image from Luo et al., 2021
cholangiocyte Ab2-krt19 labeling decreased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
liver hepatocellular carcinoma proliferative, ameliorated ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 chemical treatment by environment: MK-2206 Fig. 6 with image from Luo et al., 2021
liver ab5-akt labeling increased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Luo et al., 2021
liver Ab18-pcna labeling amount, ameliorated ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 chemical treatment by environment: MK-2206 Fig. 6 with image from Luo et al., 2021
liver necrotic, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
liver hepatocellular carcinoma proliferative, exacerbated ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 5 with image from Luo et al., 2021
liver hepatocellular carcinoma neoplastic, malignant, ameliorated ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 chemical treatment by environment: MK-2206 Fig. 6 with image from Luo et al., 2021
whole organism viability, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
liver Ab18-pcna labeling increased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with imageFig. 5 with image from Luo et al., 2021
liver ab5-akt labeling amount, ameliorated ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 chemical treatment by environment: MK-2206 Fig. 6 with image from Luo et al., 2021
liver hepatocellular carcinoma proliferative, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 6 with image from Luo et al., 2021
liver ptenb expression decreased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
liver common bile duct absent, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
liver hepatocellular carcinoma neoplastic, malignant, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 6 with image from Luo et al., 2021
liver Ab5-glul labeling amount, ameliorated ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 chemical treatment by environment: MK-2206 Fig. 6 with image from Luo et al., 2021
liver hyperplastic, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
liver Ab4-pten labeling decreased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with imageFig. 6 with image from Luo et al., 2021
liver ab11-tp53 labeling decreased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
pancreas hepatocellular adenoma neoplastic, invasive, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 4 with image from Luo et al., 2021
liver Ab5-akt1 labeling decreased amount, abnormal ptenazf3641/zf3641; ptenbzf3644/zf3644; tp53zf3638/zf3638 standard conditions Fig. 6 with image from Luo et al., 2021
Citations