CRISPR Name:	CRISPR3-plxna1b
Target:	plxna1b (1)
Source:
Target Sequence:	5' - GGACAGAACCAAAGCGAGAG - 3'
	(Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note:	This CRISPR does not appear to target correctly when blasted in the current build. It does target correctly according to the old assembly.