TALEN

TALEN1-prrx1b

ID

ZDB-TALEN-170303-3

Name

TALEN1-prrx1b

Previous Names

None

Target

prrx1b (1)

Target Sequence 1

5' - TGGCGAAACGGGCAGGACTA - 3'

Target Sequence 2

5' - TGTATCACTGCCACTCGTTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
el491	prrx1b

Expression

Gene expression in Wild Types + TALEN1-prrx1b

No data available

Phenotype

Phenotype resulting from TALEN1-prrx1b

No data available

Phenotype of all Fish created by or utilizing TALEN1-prrx1b

Phenotype	Fish	Conditions	Figures
cardiac muscle cell cell population proliferation decreased occurrence, abnormal	prrx1b^el491/el491	standard conditions	Fig. 1. from de Bakker et al., 2021
heart connective tissue replacement involved in inflammatory response wound healing increased occurrence, abnormal	prrx1b^el491/el491	standard conditions	Fig. 1. from de Bakker et al., 2021
cardiac muscle cell cell population proliferation decreased occurrence, abnormal	prrx1b^el491/el491	cold damage: heart	Fig. 5. from de Bakker et al., 2021
cardiac muscle cell cell population proliferation normal process quality, ameliorated	prrx1b^el491/el491	cold damage: heart, chemical treatment by environment: Human Heregulin-b1	Fig. 5. from de Bakker et al., 2021
cardiac muscle cell ab2-pcna labeling increased amount, abnormal	prrx1b^el491/el491	cold damage: heart	Fig. 1. from de Bakker et al., 2021
heart connective tissue replacement involved in inflammatory response wound healing increased occurrence, abnormal	prrx1b^el491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg	cold damage: heart, chemical treatment by environment: tamoxifen	Fig. 4. from de Bakker et al., 2021
ventricular epicardium nrg1 expression decreased amount, abnormal	prrx1b^el491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg	cold damage: heart, chemical treatment by environment: tamoxifen	Fig. 5. from de Bakker et al., 2021
heart fibroblast tgfb1a expression increased amount, abnormal	prrx1b^el491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg	cold damage: heart, chemical treatment by environment: tamoxifen	Fig. 4. from de Bakker et al., 2021
heart fibroblast col11a1b expression increased amount, abnormal	prrx1b^el491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg	cold damage: heart, chemical treatment by environment: tamoxifen	Fig. 4. from de Bakker et al., 2021
heart collagen biosynthetic process increased rate, abnormal	prrx1b^el491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg	cold damage: heart, chemical treatment by environment: tamoxifen	Fig. 4. from de Bakker et al., 2021
extracellular matrix organization decreased process quality, abnormal	prrx1b^el491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg	cold damage: heart, chemical treatment by environment: tamoxifen	Fig. 3. from de Bakker et al., 2021
collagen biosynthetic process decreased process quality, abnormal	prrx1b^el491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg	cold damage: heart, chemical treatment by environment: tamoxifen	Fig. 3. from de Bakker et al., 2021
blood coagulation, fibrin clot formation decreased process quality, abnormal	prrx1b^el491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg	cold damage: heart, chemical treatment by environment: tamoxifen	Fig. 3. from de Bakker et al., 2021
heart morphology, abnormal	prrx1b^el491/el491 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
determination of heart left/right asymmetry disrupted, abnormal	prrx1b^el491/el491 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
heart looping disrupted, abnormal	prrx1b^el491/el491 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
pharyngeal arch 2 postero-dorsal region barx1 expression increased amount, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
pharyngeal arch 2 dorsal margin barx1 expression mislocalised, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
pharyngeal arch 2 dorsal margin barx1 expression increased distribution, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
pharyngeal arch 2 postero-dorsal region barx1 expression mislocalised, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
pharyngeal arch ventral region barx1 expression decreased amount, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 9 from Barske et al., 2016
entopterygoid absent, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
hyomandibula morphology, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 , text only from Barske et al., 2016
palatoquadrate cartilage mislocalised, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 , Fig. 8 , text only from Barske et al., 2016
pharyngeal arch 2 barx1 expression increased distribution, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
opercle decreased size, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	text only from Barske et al., 2016
palatoquadrate cartilage morphology, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 , Fig. 8 , text only from Barske et al., 2016
hyomandibula fused with inner ear, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 , text only from Barske et al., 2016
pharyngeal arch 2 postero-dorsal region jag1b expression decreased amount, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 8 from Barske et al., 2016
pharyngeal arch 2 dorsal margin barx1 expression increased amount, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
pharyngeal arch 1 dorsal region barx1 expression increased amount, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
hyomandibula malformed, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	text only from Barske et al., 2016
pharyngeal arch 1 dorsal region barx1 expression increased distribution, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
palatoquadrate cartilage fused with neurocranial trabecula, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	text only from Barske et al., 2016
pharyngeal arch 2 postero-dorsal region barx1 expression increased distribution, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
palatoquadrate cartilage fused with inner ear, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 , Fig. 8 , text only from Barske et al., 2016
pharyngeal arch ventral region dlx5a expression decreased amount, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 9 from Barske et al., 2016
pharyngeal arch 1 dorsal region barx1 expression mislocalised, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
hyomandibular foramen absent, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	text only from Barske et al., 2016
determination of heart left/right asymmetry disrupted, abnormal	prrx1a^el558/el558; prrx1b^el491/el491 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
heart morphology, abnormal	prrx1a^el558/el558; prrx1b^el491/el491 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
heart looping disrupted, abnormal	prrx1a^el558/el558; prrx1b^el491/el491 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
determination of heart left/right asymmetry disrupted, abnormal	prrx1a^{hu13685/hu13685}; prrx1b^el491/el491 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
heart morphology, abnormal	prrx1a^{hu13685/hu13685}; prrx1b^el491/el491 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
heart looping disrupted, abnormal	prrx1a^{hu13685/hu13685}; prrx1b^el491/el491 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
palatoquadrate cartilage mislocalised, abnormal	jag1b^b1105/b1105; prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 8 from Barske et al., 2016
palatoquadrate cartilage morphology, abnormal	jag1b^b1105/b1105; prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 8 from Barske et al., 2016
palatoquadrate cartilage fused with inner ear, abnormal	jag1b^b1105/b1105; prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 8 from Barske et al., 2016
pharyngeal arch cartilage ventral region morphology, abnormal	edn1^{tf216b/tf216b}; jag1b^b1105/b1105; prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 9 from Barske et al., 2016
Meckel's cartilage length, ameliorated	edn1^{tf216b/tf216b}; jag1b^b1105/b1105; prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 9 from Barske et al., 2016
ceratohyal cartilage size, ameliorated	edn1^{tf216b/tf216b}; jag1b^b1105/b1105; prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 9 from Barske et al., 2016

Citations