Morpholino

MO2-ntrk2b

ID
ZDB-MRPHLNO-190716-1
Name
MO2-ntrk2b
Previous Names
None
Target
Sequence
5' - TTCCACGAACCCCTGCGGTCATAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ntrk2b
Phenotype
Phenotype resulting from MO2-ntrk2b
Phenotype Fish Figures
caudal periventricular hypothalamus has fewer parts of type caudal periventricular hypothalamus serotonergic neuron, abnormal WT + MO2-ntrk2b Fig. 6 with image from Sahu et al., 2019
caudal tuberculum ventral region slc6a4a expression absent, abnormal WT + MO2-ntrk2b Fig. 5 with image from Sahu et al., 2019
diencephalon dopaminergic neuron th expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 3 with image from Sahu et al., 2019
diencephalon dopaminergic neuron th2 expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 3 with image from Sahu et al., 2019
diencephalon ventral region has fewer parts of type diencephalon dopaminergic neuron, abnormal WT + MO2-ntrk2b Fig. 4 with image from Sahu et al., 2019
paraventricular organ has fewer parts of type paraventricular organ serotonergic neuron, abnormal WT + MO2-ntrk2b Fig. 6 with image from Sahu et al., 2019
raphe nucleus tph2 expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 5 with image from Sahu et al., 2019
raphe nucleus slc6a4a expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 5 with image from Sahu et al., 2019
whole organism th expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 3 with image from Sahu et al., 2019
whole organism bdnf expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 2 with image from Sahu et al., 2019
whole organism th2 expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 3 with image from Sahu et al., 2019
whole organism ntrk2b expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 2 with image from Sahu et al., 2019
whole organism tph2 expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 5 with image from Sahu et al., 2019
whole organism dopamine decreased amount, abnormal WT + MO2-ntrk2b Fig. 3 with image from Sahu et al., 2019
whole organism serotonin decreased amount, abnormal WT + MO2-ntrk2b Fig. 5 with image from Sahu et al., 2019
Phenotype of all Fish created by or utilizing MO2-ntrk2b
Phenotype Fish Conditions Figures
whole organism th expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 3 with image from Sahu et al., 2019
whole organism tph2 expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 5 with image from Sahu et al., 2019
diencephalon ventral region has fewer parts of type diencephalon dopaminergic neuron, abnormal WT + MO2-ntrk2b standard conditions Fig. 4 with image from Sahu et al., 2019
caudal tuberculum ventral region slc6a4a expression absent, abnormal WT + MO2-ntrk2b standard conditions Fig. 5 with image from Sahu et al., 2019
caudal periventricular hypothalamus has fewer parts of type caudal periventricular hypothalamus serotonergic neuron, abnormal WT + MO2-ntrk2b standard conditions Fig. 6 with image from Sahu et al., 2019
whole organism serotonin decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 5 with image from Sahu et al., 2019
whole organism th2 expression decreased amount, abnormal WT + MO2-ntrk2b control Fig. 3 with image from Sahu et al., 2019
diencephalon dopaminergic neuron th2 expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 3 with image from Sahu et al., 2019
diencephalon dopaminergic neuron th expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 3 with image from Sahu et al., 2019
whole organism dopamine decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 3 with image from Sahu et al., 2019
raphe nucleus slc6a4a expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 5 with image from Sahu et al., 2019
whole organism ntrk2b expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 2 with image from Sahu et al., 2019
whole organism bdnf expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 2 with image from Sahu et al., 2019
raphe nucleus tph2 expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 5 with image from Sahu et al., 2019
paraventricular organ has fewer parts of type paraventricular organ serotonergic neuron, abnormal WT + MO2-ntrk2b standard conditions Fig. 6 with image from Sahu et al., 2019
Citations