Morpholino

MO1-cpt1aa

ID
ZDB-MRPHLNO-181102-1
Name
MO1-cpt1aa
Previous Names
None
Target
Sequence
5' - CCACAGCCTGATGAGCTTCTGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cpt1aa
Expressed Gene Anatomy Figures
baxa Fig. 3 from Ulhaq et al., 2023
bcl2l1 Fig. 3 from Ulhaq et al., 2023
ccna2 Fig. 3 from Ulhaq et al., 2023
ccnd1 Fig. 3 from Ulhaq et al., 2023
cdk1 Fig. 3 from Ulhaq et al., 2023
cebpa Fig. 1 from Ulhaq et al., 2023
fabp1a Fig. 1 from Ulhaq et al., 2023
fas Fig. 1 from Ulhaq et al., 2023
gpx4b Fig. 3 from Ulhaq et al., 2023
grk1a Fig. 2 from Ulhaq et al., 2023
gss Fig. 3 from Ulhaq et al., 2023
hif1aa Fig. 1 from Ulhaq et al., 2023
insra Fig. 1 from Ulhaq et al., 2023
insrb Fig. 1 from Ulhaq et al., 2023
lpla Fig. 1 from Ulhaq et al., 2023
mlxip Fig. 1 from Ulhaq et al., 2023
opn1lw1 Fig. 2 from Ulhaq et al., 2023
opn1lw2 Fig. 2 from Ulhaq et al., 2023
opn1mw1 Fig. 2 from Ulhaq et al., 2023
opn1mw2 Fig. 2 from Ulhaq et al., 2023
opn1mw3 Fig. 2 from Ulhaq et al., 2023
opn1mw4 Fig. 2 from Ulhaq et al., 2023
opn1sw1 Fig. 2 from Ulhaq et al., 2023
opn1sw2 Fig. 2 from Ulhaq et al., 2023
ppap2d Fig. 1 from Ulhaq et al., 2023
rho Fig. 2 from Ulhaq et al., 2023
rpe65a Fig. 2 from Ulhaq et al., 2023
slc2a1b Fig. 1 from Ulhaq et al., 2023
slc2a2 Fig. 1 from Ulhaq et al., 2023
sod1 Fig. 3 from Ulhaq et al., 2023
srebf1 Fig. 1 from Ulhaq et al., 2023
trarg1b Fig. 1 from Ulhaq et al., 2023
vim Fig. 2 from Ulhaq et al., 2023
Phenotype
Phenotype resulting from MO1-cpt1aa
Phenotype Fish Figures
Bruch's membrane increased accumulation Bruch's membrane lipid droplet, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
eye decreased size, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
eye ferroptosis increased occurrence, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
eye malonaldehyde increased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
eye reactive oxygen species biosynthetic process increased occurrence, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
eye photoreceptor cell cell death increased occurrence, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
eye photoreceptor cell photoreceptor connecting cilium decreased length, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
fatty acid beta-oxidation decreased process quality, abnormal y1Tg + MO1-cpt1aa Fig. 1 from Zecchin et al., 2018
lymphangiogenic sprout lymphangiogenesis process quality, abnormal y1Tg + MO1-cpt1aa Fig. 1 from Zecchin et al., 2018
parachordal vessel lymph vessel development decreased occurrence, abnormal y1Tg + MO1-cpt1aa Fig. 1 from Zecchin et al., 2018
pericardium edematous, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
photoreceptor outer segment layer decreased thickness, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
post-vent region increased curvature, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
retinal inner nuclear layer increased accumulation retinal inner nuclear layer lipid droplet, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
retinal inner nuclear layer intermediate filament vim expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
retinal rod cell rod photoreceptor outer segment rho expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
thoracic duct absent, abnormal y1Tg + MO1-cpt1aa Fig. 2 from Zecchin et al., 2018
thoracic duct lymph vessel development decreased occurrence, abnormal y1Tg + MO1-cpt1aa Fig. 2 from Zecchin et al., 2018
whole organism cdk1 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
whole organism rpe65a expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
whole organism opn1mw1 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
whole organism sod1 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
whole organism ccna2 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
whole organism gpx4b expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
whole organism gss expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
whole organism ccnd1 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 3 from Ulhaq et al., 2023
whole organism opn1lw2 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
whole organism rho expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
whole organism slc2a1b expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
whole organism opn1sw2 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
whole organism opn1mw4 expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 2 from Ulhaq et al., 2023
whole organism trarg1b expression decreased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
whole organism srebf1 expression increased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
whole organism hif1aa expression increased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
whole organism ppap2d expression increased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
whole organism glucose decreased amount, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
yolk increased accumulation yolk lipid droplet, abnormal AB + MO1-cpt1aa Fig. 1 from Ulhaq et al., 2023
Phenotype of all Fish created by or utilizing MO1-cpt1aa
Phenotype Fish Conditions Figures
whole organism opn1mw4 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
whole organism ppap2d expression increased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism ccna2 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism opn1mw1 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
yolk increased accumulation yolk lipid droplet, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
eye decreased size, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism slc2a1b expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism gss expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism rho expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
eye malonaldehyde increased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
eye reactive oxygen species biosynthetic process increased occurrence, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism gpx4b expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism glucose decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism trarg1b expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism sod1 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism opn1lw2 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
retinal rod cell rod photoreceptor outer segment rho expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
whole organism cdk1 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism opn1sw2 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
Bruch's membrane increased accumulation Bruch's membrane lipid droplet, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
eye photoreceptor cell cell death increased occurrence, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism hif1aa expression increased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
visual behavior process quality, abnormal AB + MO1-cpt1aa lighting conditions Fig. 4 from Ulhaq et al., 2023
post-vent region increased curvature, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
photoreceptor outer segment layer decreased thickness, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism rpe65a expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
pericardium edematous, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
eye photoreceptor cell photoreceptor connecting cilium decreased length, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
retinal inner nuclear layer increased accumulation retinal inner nuclear layer lipid droplet, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
whole organism srebf1 expression increased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
retinal inner nuclear layer intermediate filament vim expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 2 from Ulhaq et al., 2023
whole organism ccnd1 expression decreased amount, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
eye ferroptosis increased occurrence, abnormal AB + MO1-cpt1aa standard conditions Fig. 3 from Ulhaq et al., 2023
thoracic duct absent, abnormal y1Tg + MO1-cpt1aa standard conditions Fig. 2 from Zecchin et al., 2018
fatty acid beta-oxidation decreased process quality, abnormal y1Tg + MO1-cpt1aa standard conditions Fig. 1 from Zecchin et al., 2018
parachordal vessel lymph vessel development decreased occurrence, abnormal y1Tg + MO1-cpt1aa standard conditions Fig. 1 from Zecchin et al., 2018
thoracic duct lymph vessel development decreased occurrence, abnormal y1Tg + MO1-cpt1aa standard conditions Fig. 2 from Zecchin et al., 2018
lymphangiogenic sprout lymphangiogenesis process quality, abnormal y1Tg + MO1-cpt1aa standard conditions Fig. 1 from Zecchin et al., 2018
eye decreased size, abnormal tp53zdf1/zdf1 + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
retina apoptotic process increased occurrence, abnormal tp53zdf1/zdf1 + MO1-cpt1aa standard conditions Fig. 1 from Ulhaq et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.