Morpholino

MO3-zic2a

ID
ZDB-MRPHLNO-070522-3
Name
MO3-zic2a
Previous Names
  • 2MOC (1)
  • zic2aMO (1)
Target
Sequence
5' - CTCACCTGAGAAGGAAAACATCATA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
intron 1 / exon 2 splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-zic2a
Expressed Gene Anatomy Figures
aldh1a3 Fig. 6 with image from Sanek et al., 2009
arxa Fig. 4 with image from Sanek et al., 2009
Fig. 1 with imageFig. 4 with image from Sanek et al., 2008
col2a1a Fig. 3 with image from Teslaa et al., 2013
dbx1a Fig. 2 with image from Sanek et al., 2008
dlx2a Fig. 7 with imageFig. 8 with image from Teslaa et al., 2013
Fig. 4 with image from Sanek et al., 2009
Fig. 2 with imageFig. 4 with imageFig. 5 with imageFig. S4 with image from Sanek et al., 2008
emx1 Fig. 2 with image from Sanek et al., 2008
eomesa Fig. S3 with image from Sanek et al., 2008
fezf2 Fig. S1 with image from Sanek et al., 2008
fgf8a Fig. 5 with image from Sanek et al., 2009
foxg1a Fig. 2 with imageFig. S3 with imageFig. S4 with image from Sanek et al., 2008
gch2 Fig. 6 with image from Teslaa et al., 2013
gli1 Fig. 7 with image from Sanek et al., 2008
gli2a Fig. 7 with image from Sanek et al., 2008
gli3 Fig. 7 with image from Sanek et al., 2008
irx1b Fig. 7 with imageFig. S1 with image from Sanek et al., 2008
isl1a Fig. 3 with image from Sanek et al., 2008
lef1 Fig. S3 with image from Sanek et al., 2008
lhx1a Fig. S3 with image from Sanek et al., 2008
mitfa Fig. 6 with image from Teslaa et al., 2013
nkx2.1 Fig. 2 with image from Sanek et al., 2008
nkx2.2a Fig. 7 with image from Sanek et al., 2008
nkx2.4b Fig. S3 with image from Sanek et al., 2008
otpb Fig. 3 with image from Sanek et al., 2008
oxt Fig. 3 with image from Sanek et al., 2008
pax2a Fig. 5 with imageFig. 6 with imageFig. 9 with image from Sanek et al., 2009
pax6a Fig. 6 with image from Sanek et al., 2009
Fig. 2 with image from Sanek et al., 2008
pitx2 Fig. 8 with image from Teslaa et al., 2013
ptch2 Fig. 7 with image from Sanek et al., 2008
rx3 Fig. 5 with image from Sanek et al., 2009
Fig. S1 with imageFig. S3 with image from Sanek et al., 2008
shha Fig. 2 with imageFig. 7 with imageFig. S4 with image from Sanek et al., 2008
sim1a Fig. 3 with image from Sanek et al., 2008
six3b Fig. 2 with imageFig. 3 with image from Sanek et al., 2009
Fig. S1 with image from Sanek et al., 2008
snai1b Fig. 4 with image from Teslaa et al., 2013
sox9a Fig. 3 with image from Teslaa et al., 2013
sox10 Fig. 5 with image from Teslaa et al., 2013
vax1 Fig. 5 with image from Sanek et al., 2009
wnt1 Fig. 7 with image from Nyholm et al., 2007
Phenotype
Phenotype resulting from MO3-zic2a
Phenotype Fish Figures
cranial neural crest mislocalised dorsally, abnormal WT + MO3-zic2a Fig. 5 with image from Teslaa et al., 2013
diencephalon development disrupted, abnormal AB + MO3-zic2a Fig. 1 with imageFig. 2 with imageFig. 5 with image from Sanek et al., 2008
embryonic neurocranium morphogenesis decreased process quality, abnormal WT + MO3-zic2a Fig. 3 with image from Teslaa et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO3-zic2a Fig. 1 with imageFig. 3 with imageFig. 7 with image from Teslaa et al., 2013
ethmoid cartilage medial region absent, abnormal WT + MO3-zic2a Fig. 3 with image from Teslaa et al., 2013
forebrain development decreased process quality, abnormal WT + MO3-zic2a Fig. 8 with image from Teslaa et al., 2013
fourth ventricle malformed, abnormal WT + MO3-zic2a text only from Nyholm et al., 2007
head has fewer parts of type xanthoblast, abnormal WT + MO3-zic2a Fig. 6 with image from Teslaa et al., 2013
hindbrain malformed, abnormal WT + MO3-zic2a Fig. 7 with image from Nyholm et al., 2007
hypothalamus cellular quality, abnormal WT + MO3-zic2a Fig. 8 with image from Teslaa et al., 2013
midbrain malformed, abnormal WT + MO3-zic2a Fig. 7 with image from Nyholm et al., 2007
negative regulation of DNA-templated transcription disrupted, abnormal AB + MO3-zic2a Fig. 2 with imageFig. 3 with image from Sanek et al., 2009
neural crest cell migration decreased process quality, abnormal WT + MO3-zic2a Fig. 5 with image from Teslaa et al., 2013
neural tube malformed, abnormal WT + MO3-zic2a text only from Nyholm et al., 2007
neurocranial trabecula shortened, abnormal WT + MO3-zic2a Fig. 3 with image from Teslaa et al., 2013
neurogenesis disrupted, abnormal AB + MO3-zic2a Fig. 3 with image from Sanek et al., 2008
optic fissure closure incomplete, abnormal AB + MO3-zic2a Fig. 6 with image from Sanek et al., 2009
optic fissure malformed, abnormal WT + MO3-zic2a text only from Nyholm et al., 2007
pharyngeal arch cellular quality, abnormal WT + MO3-zic2a Fig. 3 with image from Teslaa et al., 2013
pharyngeal arch 1 decreased size, abnormal WT + MO3-zic2a Fig. 7 with image from Teslaa et al., 2013
pharyngeal arch 2 decreased size, abnormal WT + MO3-zic2a Fig. 7 with image from Teslaa et al., 2013
pharyngeal arch 2 malformed, abnormal WT + MO3-zic2a Fig. 1 with image from Teslaa et al., 2013
pharyngeal arch cartilage hypoplastic, abnormal WT + MO3-zic2a Fig. 1 with image from Teslaa et al., 2013
regulation of smoothened signaling pathway disrupted, abnormal AB + MO3-zic2a Fig. 3 with image from Sanek et al., 2009
retinal neural layer decreased size, abnormal WT + MO3-zic2a text only from Nyholm et al., 2007
stomodeum decreased size, abnormal WT + MO3-zic2a Fig. 8 with image from Teslaa et al., 2013
tectal ventricle malformed, abnormal WT + MO3-zic2a text only from Nyholm et al., 2007
trunk has fewer parts of type xanthoblast, abnormal WT + MO3-zic2a Fig. 6 with image from Teslaa et al., 2013
ventral mandibular arch malformed, abnormal WT + MO3-zic2a Fig. 1 with image from Teslaa et al., 2013
ventral thalamus cellular quality, abnormal WT + MO3-zic2a Fig. 8 with image from Teslaa et al., 2013
ventral thalamus decreased size, abnormal AB + MO3-zic2a Fig. 1 with imageFig. 2 with imageFig. S3 with imageFig. S4 with image from Sanek et al., 2008
xanthophore differentiation decreased process quality, abnormal WT + MO3-zic2a Fig. 6 with image from Teslaa et al., 2013
Phenotype of all Fish created by or utilizing MO3-zic2a
Phenotype Fish Conditions Figures
diencephalon development disrupted, abnormal Df(Chr07)t4/t4 + MO3-zic2a standard conditions Fig. 5 with image from Sanek et al., 2008
diencephalon development disrupted, abnormal AB + MO3-zic2a chemical treatment: ethanol Fig. 6 with image from Sanek et al., 2008
ventral thalamus decreased size, abnormal AB + MO3-zic2a chemical treatment: ethanol Fig. 6 with image from Sanek et al., 2008
cell proliferation in forebrain disrupted, abnormal AB + MO3-zic2a chemical treatment: 5-bromo-2'-deoxyuridine Fig. 4 with image from Sanek et al., 2008
diencephalon development disrupted, abnormal AB + MO3-zic2a chemical treatment: ethanol, chemical treatment: Cyclopamine Fig. 6 with image from Sanek et al., 2008
ventral thalamus decreased size, abnormal AB + MO3-zic2a chemical treatment: ethanol, chemical treatment: Cyclopamine Fig. 6 with image from Sanek et al., 2008
optic fissure closure incomplete, abnormal AB + MO3-zic2a standard conditions Fig. 6 with image from Sanek et al., 2009
diencephalon development disrupted, abnormal AB + MO3-zic2a standard conditions Fig. 1 with imageFig. 2 with imageFig. 5 with image from Sanek et al., 2008
ventral thalamus decreased size, abnormal AB + MO3-zic2a standard conditions Fig. 1 with imageFig. 2 with imageFig. S3 with imageFig. S4 with image from Sanek et al., 2008
negative regulation of DNA-templated transcription disrupted, abnormal AB + MO3-zic2a standard conditions Fig. 2 with imageFig. 3 with image from Sanek et al., 2009
regulation of smoothened signaling pathway disrupted, abnormal AB + MO3-zic2a standard conditions Fig. 3 with image from Sanek et al., 2009
neurogenesis disrupted, abnormal AB + MO3-zic2a standard conditions Fig. 3 with image from Sanek et al., 2008
neural crest cell migration decreased process quality, abnormal WT + MO3-zic2a standard conditions Fig. 5 with image from Teslaa et al., 2013
trunk has fewer parts of type xanthoblast, abnormal WT + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
head has fewer parts of type xanthoblast, abnormal WT + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
hypothalamus cellular quality, abnormal WT + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
pharyngeal arch 1 decreased size, abnormal WT + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
fourth ventricle malformed, abnormal WT + MO3-zic2a standard conditions text only from Nyholm et al., 2007
tectal ventricle malformed, abnormal WT + MO3-zic2a standard conditions text only from Nyholm et al., 2007
neurocranial trabecula shortened, abnormal WT + MO3-zic2a standard conditions Fig. 3 with image from Teslaa et al., 2013
midbrain malformed, abnormal WT + MO3-zic2a standard conditions Fig. 7 with image from Nyholm et al., 2007
ventral mandibular arch malformed, abnormal WT + MO3-zic2a standard conditions Fig. 1 with image from Teslaa et al., 2013
forebrain development decreased process quality, abnormal WT + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
pharyngeal arch 2 malformed, abnormal WT + MO3-zic2a standard conditions Fig. 1 with image from Teslaa et al., 2013
pharyngeal arch 2 decreased size, abnormal WT + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
retinal neural layer decreased size, abnormal WT + MO3-zic2a standard conditions text only from Nyholm et al., 2007
cranial neural crest mislocalised dorsally, abnormal WT + MO3-zic2a standard conditions Fig. 5 with image from Teslaa et al., 2013
hindbrain malformed, abnormal WT + MO3-zic2a standard conditions Fig. 7 with image from Nyholm et al., 2007
optic fissure malformed, abnormal WT + MO3-zic2a standard conditions text only from Nyholm et al., 2007
ethmoid cartilage medial region absent, abnormal WT + MO3-zic2a standard conditions Fig. 3 with image from Teslaa et al., 2013
embryonic neurocranium morphogenesis decreased process quality, abnormal WT + MO3-zic2a standard conditions Fig. 3 with image from Teslaa et al., 2013
pharyngeal arch cellular quality, abnormal WT + MO3-zic2a standard conditions Fig. 3 with image from Teslaa et al., 2013
xanthophore differentiation decreased process quality, abnormal WT + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
neural tube malformed, abnormal WT + MO3-zic2a standard conditions text only from Nyholm et al., 2007
pharyngeal arch cartilage hypoplastic, abnormal WT + MO3-zic2a standard conditions Fig. 1 with image from Teslaa et al., 2013
ventral thalamus cellular quality, abnormal WT + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
stomodeum decreased size, abnormal WT + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO3-zic2a standard conditions Fig. 1 with imageFig. 3 with imageFig. 7 with image from Teslaa et al., 2013
negative regulation of DNA-templated transcription disrupted, abnormal smob641/b641 + MO3-zic2a standard conditions Fig. 3 with image from Sanek et al., 2009
diencephalon development disrupted, abnormal smob641/b641 + MO3-zic2a standard conditions Fig. 5 with image from Sanek et al., 2008
regulation of smoothened signaling pathway disrupted, abnormal smob641/b641 + MO3-zic2a standard conditions Fig. 3 with image from Sanek et al., 2009
alar plate midbrain region apical junction complex patchy, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 4 from Nyholm et al., 2009
midbrain malformed, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2Fig. 6 from Nyholm et al., 2009
Fig. 7 with imageFig. 8 with image from Nyholm et al., 2007
cell proliferation in midbrain disrupted, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 9 with image from Nyholm et al., 2007
actin-myosin filament sliding decreased rate, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 3 from Nyholm et al., 2009
secondary neural tube formation process quality, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2 from Nyholm et al., 2009
tectal ventricle malformed, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2 from Nyholm et al., 2009
Fig. 7 with imageFig. 8 with image from Nyholm et al., 2007
tectal ventricle decreased size, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2 from Nyholm et al., 2009
hindbrain malformed, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 7 with imageFig. 8 with image from Nyholm et al., 2007
regulation of mitotic cell cycle, embryonic process quality, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 6 from Nyholm et al., 2009
alar plate midbrain region physical object quality, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 3 from Nyholm et al., 2009
midbrain development process quality, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2Fig. 6 from Nyholm et al., 2009
ventral thalamus cellular quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
xanthophore differentiation decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
melanoblast mislocalised, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
neural crest cell differentiation decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 4 with image from Teslaa et al., 2013
pharyngeal arch 1 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
melanocyte migration decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
pharyngeal arch 2 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
neural crest cell cellular quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 4 with image from Teslaa et al., 2013
neural crest cell migration decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 5 with image from Teslaa et al., 2013
melanoblast aggregated, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
forebrain development decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
head has fewer parts of type melanoblast, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
melanocyte differentiation decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
pharyngeal arch 3 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
cranial neural crest mislocalised dorsally, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 5 with image from Teslaa et al., 2013
head has fewer parts of type xanthoblast, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
pharyngeal arch 4 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
trunk has fewer parts of type melanoblast, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
hypothalamus cellular quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
rhombomere 3 decreased size, abnormal WT + MO2-zic2b + MO2-zic3 + MO3-zic2a standard conditions Fig. 6 with image from Drummond et al., 2013
rhombomere 5 decreased size, abnormal WT + MO2-zic2b + MO2-zic3 + MO3-zic2a standard conditions Fig. 6 with image from Drummond et al., 2013
motor nucleus of vagal nerve anatomical region decreased size, abnormal rw0Tg + MO2-zic2b + MO3-zic2a + MO4-tp53 standard conditions Fig. 10 with image from Drummond et al., 2013
retinoic acid receptor signaling pathway decreased process quality, abnormal sk71Tg + MO2-zic2b + MO3-zic2a + MO4-tp53 standard conditions Fig. 8 with image from Drummond et al., 2013
Citations