CRISPR

CRISPR1-capza1a

ID

ZDB-CRISPR-231025-3

Name

CRISPR1-capza1a

Previous Names

None

Target

capza1a (1)

Sequence

5' - GAGGGTCAAAGAATCGGCCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
pc55	capza1a

Expression

Gene expression in Wild Types + CRISPR1-capza1a

No data available

Phenotype

Phenotype resulting from CRISPR1-capza1a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-capza1a

Phenotype	Fish	Conditions	Figures
trunk capza1a expression decreased amount, abnormal	capza1a^pc55/pc55 (TU)	standard conditions	Fig 4 from Berger et al., 2022
myotome skeletal muscle myofibril decreased amount, abnormal	capza1a^pc55/+; capza1b^pc56/+ (TU)	standard conditions	Fig 4 from Berger et al., 2022
myotome myofibril assembly decreased process quality, abnormal	capza1a^pc55/+; capza1b^pc56/+ (TU)	standard conditions	Fig 4 from Berger et al., 2022
myotome myofibril assembly decreased process quality, abnormal	capza1a^pc55/+; capza1b^pc56/pc56 (TU)	standard conditions	Fig 4 from Berger et al., 2022
myotome skeletal muscle myofibril decreased amount, abnormal	capza1a^pc55/+; capza1b^pc56/pc56 (TU)	standard conditions	Fig 4 from Berger et al., 2022
myotome striated muscle thin filament mislocalised, abnormal	capza1a^pc55/+; capza1b^pc56/pc56; pc21Tg; pc22Tg	standard conditions	Fig 6 from Berger et al., 2022
myotome sarcomere EGFP expression mislocalised, abnormal	capza1a^pc55/+; capza1b^pc56/pc56; pc21Tg; pc22Tg	standard conditions	Fig 6 from Berger et al., 2022
myotome sarcomere EGFP expression spatial pattern, abnormal	capza1a^pc55/+; capza1b^pc56/pc56; pc21Tg; pc22Tg	standard conditions	Fig 6 from Berger et al., 2022
myotome peripheral region has extra parts of type myotome protein-containing complex, abnormal	capza1a^pc55/+; capza1b^pc56/pc56; pc21Tg; pc22Tg	standard conditions	Fig 6 from Berger et al., 2022
myotome skeletal muscle myofibril decreased amount, abnormal	capza1a^pc55/pc55; capza1b^pc56/+ (TU)	standard conditions	Fig 4 from Berger et al., 2022
myotome myofibril assembly decreased process quality, abnormal	capza1a^pc55/pc55; capza1b^pc56/+ (TU)	standard conditions	Fig 4 from Berger et al., 2022
myotome peripheral region has extra parts of type myotome protein-containing complex, abnormal	capza1a^pc55/pc55; capza1b^pc56/pc56 (TU)	standard conditions	Fig 6 from Berger et al., 2022
whole organism dead, abnormal	capza1a^pc55/pc55; capza1b^pc56/pc56 (TU)	standard conditions	Fig 4 from Berger et al., 2022
myotome striated muscle thin filament mislocalised, abnormal	capza1a^pc55/pc55; capza1b^pc56/pc56 (TU)	standard conditions	Fig 6 from Berger et al., 2022
myotome sarcomere EGFP expression mislocalised, abnormal	capza1a^pc55/pc55; capza1b^pc56/pc56; pc21Tg; pc22Tg	standard conditions	Fig 6 from Berger et al., 2022
myotome striated muscle thin filament mislocalised, abnormal	capza1a^pc55/pc55; capza1b^pc56/pc56; pc21Tg; pc22Tg	standard conditions	Fig 6 from Berger et al., 2022
myotome sarcomere EGFP expression spatial pattern, abnormal	capza1a^pc55/pc55; capza1b^pc56/pc56; pc21Tg; pc22Tg	standard conditions	Fig 6 from Berger et al., 2022
myotome peripheral region has extra parts of type myotome protein-containing complex, abnormal	capza1a^pc55/pc55; capza1b^pc56/pc56; pc21Tg; pc22Tg	standard conditions	Fig 6 from Berger et al., 2022

Citations